ID: 1072545133

View in Genome Browser
Species Human (GRCh38)
Location 10:96431557-96431579
Sequence GTACCTGCGGCCAATGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072545133_1072545137 6 Left 1072545133 10:96431557-96431579 CCATTGACATTGGCCGCAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1072545137 10:96431586-96431608 GGCATATTTGCTACCTGCCTAGG No data
1072545133_1072545140 28 Left 1072545133 10:96431557-96431579 CCATTGACATTGGCCGCAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1072545140 10:96431608-96431630 GATGTGCCGCGCCCTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072545133 Original CRISPR GTACCTGCGGCCAATGTCAA TGG (reversed) Intronic
901318338 1:8323937-8323959 GGACCTGCGGCCCATTTCCAGGG - Intronic
1069990887 10:72315353-72315375 GTCCCTGCTGCCATTGTCATGGG + Intergenic
1072545133 10:96431557-96431579 GTACCTGCGGCCAATGTCAATGG - Intronic
1086164245 11:83759368-83759390 GTACCTGCGGTGAATAGCAAGGG + Intronic
1086983472 11:93223825-93223847 GCACCTGGGGCCAGTGTCAGGGG + Intergenic
1088580348 11:111309833-111309855 GTACCTGTGGCCAATGCTGAAGG - Intergenic
1096814162 12:54191244-54191266 GTCCCTACAGCCAATGTCAGAGG + Intergenic
1103227373 12:119299588-119299610 GTACCTGGGGCCAGTGTTTATGG - Intergenic
1110980778 13:81894607-81894629 GTACCAGTGGCCAAAGTAAAGGG + Intergenic
1117645349 14:57845835-57845857 GTACCTAAGTCCAAAGTCAAAGG + Intronic
1126789923 15:52211697-52211719 ATACCAGGGGCCAATGTCAAAGG + Intronic
1132935655 16:2479482-2479504 GTACCTGCTGCCAATGCTGATGG - Intronic
1138393784 16:56689279-56689301 GTACCAGTGGCCAATGGCAGTGG - Intronic
1138678295 16:58667337-58667359 GTTCCTGCGACCAATGGCAAAGG + Exonic
1168626738 19:57924441-57924463 GTAGCTGAGGCCATTGTCAAAGG - Intronic
930028348 2:47043502-47043524 GTACCAGCGCCCAAGGTCATGGG + Intronic
935964924 2:108463991-108464013 GTACCTGAGAGCAATGTCCAGGG - Intronic
940377757 2:152975789-152975811 GTACTTGGGCCCAATGTGAACGG - Intergenic
941610311 2:167653689-167653711 GTACCTGCACCCAGTGTCGAGGG + Intergenic
1172465163 20:35151017-35151039 GTATCTGAGGCCAATGTCCTCGG + Intergenic
1178494501 21:33075550-33075572 GTACCTGCGGCCTTTGTCCCAGG - Intergenic
1181481465 22:23201833-23201855 AAACCTGCAGCCAATGTCCACGG - Intronic
1184610150 22:45598311-45598333 GTACCATCGGCCAATTTCTATGG - Intronic
950596090 3:13983517-13983539 GTATCTGTGGCCATTGTAAATGG + Intronic
951126275 3:18988009-18988031 ATACCTGCTGCCACTGTTAAAGG + Intergenic
951189001 3:19747671-19747693 GTACCTGTAACCAATGTCAGAGG + Intergenic
956396714 3:68833817-68833839 GAACATGAGGCCAGTGTCAAAGG + Intronic
961367364 3:126408597-126408619 GCACCTGGGGCTAATGTCCAAGG - Intronic
967891548 3:194367671-194367693 GGACCTGGGGCCAAGGTCACAGG + Intronic
968717760 4:2174309-2174331 GGACCTGCGGTCAAAGGCAAAGG + Intronic
976144777 4:82031856-82031878 GTACCTGAGGCCAGTCTCATAGG - Intronic
977094372 4:92720810-92720832 GTCCCTGCTGCCAATGTTTATGG - Intronic
981954185 4:150449396-150449418 GTACCTGAGGACCATTTCAATGG + Intronic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
997207745 5:132059890-132059912 GTACCTGAGGACACTGTCACTGG - Intergenic
997878758 5:137571567-137571589 GTACCTCCGGCCAATCACAAGGG - Intronic
1004257959 6:14082401-14082423 ATTCCTGCTGCCACTGTCAAAGG - Intergenic
1010544119 6:77128784-77128806 TTTCCTGTGGCCATTGTCAATGG - Intergenic
1022922870 7:35034052-35034074 GTTCCTGTGGTCAATGGCAAGGG - Intronic
1023043528 7:36193154-36193176 ATGCCTGCTGCCAATGTCCACGG - Intronic
1040595330 8:48832664-48832686 TTACATGCGGCCAATGCCACAGG + Intergenic
1045520948 8:102902774-102902796 GTAGCTGTGGCAAATGTTAATGG - Intronic
1049536925 8:143186714-143186736 GCACCTGCAGCCACTGGCAAGGG + Intergenic
1053284709 9:36842708-36842730 GTGCCTGTGGCCGATGTGAAGGG - Intronic
1058588146 9:106532460-106532482 GAAGCTGCTGCCAATGTAAAAGG - Intergenic
1060753940 9:126196152-126196174 ATAGCTGAGCCCAATGTCAAGGG - Intergenic
1061822035 9:133234356-133234378 TTCCCTGGGGCCAATGCCAAGGG + Intergenic
1187146675 X:16643803-16643825 CTAGCTGGGGCCATTGTCAATGG + Intronic