ID: 1072546156

View in Genome Browser
Species Human (GRCh38)
Location 10:96441134-96441156
Sequence GACATGGCTGTGCCTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072546156_1072546162 17 Left 1072546156 10:96441134-96441156 CCAGCTGAAGGCACAGCCATGTC 0: 1
1: 0
2: 2
3: 11
4: 190
Right 1072546162 10:96441174-96441196 TGAGGCAGCCTTCTCCAGTGAGG No data
1072546156_1072546159 -1 Left 1072546156 10:96441134-96441156 CCAGCTGAAGGCACAGCCATGTC 0: 1
1: 0
2: 2
3: 11
4: 190
Right 1072546159 10:96441156-96441178 CATAAACAGAACCAGGCCTGAGG No data
1072546156_1072546157 -8 Left 1072546156 10:96441134-96441156 CCAGCTGAAGGCACAGCCATGTC 0: 1
1: 0
2: 2
3: 11
4: 190
Right 1072546157 10:96441149-96441171 GCCATGTCATAAACAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072546156 Original CRISPR GACATGGCTGTGCCTTCAGC TGG (reversed) Intronic
904499493 1:30906120-30906142 GAGAGGGCAGTGCCTGCAGCAGG - Intronic
905919070 1:41707296-41707318 GACATGGTTCTGCCTTCTGTGGG - Intronic
906510750 1:46409329-46409351 GACCTCGCTGTCCCTCCAGCTGG + Intronic
906792706 1:48672694-48672716 GTGATGTCTGGGCCTTCAGCTGG - Intronic
907305266 1:53509662-53509684 GTCCAGGCTGTGCCCTCAGCTGG + Intronic
907412405 1:54292039-54292061 GCAATGGCTGGGCCTGCAGCTGG + Intronic
909578768 1:77207744-77207766 CACATGCCTGTGCCTTTAGTAGG + Intronic
920424298 1:205861318-205861340 GAAAAGGCTGTGACTGCAGCAGG + Intergenic
922458569 1:225797039-225797061 GAAAAGGCTGTGACTGCAGCGGG - Intergenic
922864575 1:228848583-228848605 CCCACGGCTCTGCCTTCAGCTGG + Intergenic
923274783 1:232386568-232386590 GAGAGGGCTGAGCCTTGAGCAGG - Intergenic
1063159910 10:3411771-3411793 CACATAGCTGAGCCTTCACCAGG - Intergenic
1063308184 10:4926037-4926059 TAGATGGCTGTGCCTTCCACAGG + Intronic
1063318544 10:5031737-5031759 TAGATGGCTGTGCCTTCCACAGG - Intronic
1067061623 10:43080784-43080806 GGCATGGCTGTGCCAGCAGAAGG + Intronic
1072148946 10:92669739-92669761 GACATGGCTGCGGCTTGAGTGGG + Intergenic
1072546156 10:96441134-96441156 GACATGGCTGTGCCTTCAGCTGG - Intronic
1072570569 10:96654520-96654542 GACAAGGCTGGGCCTGCAGCAGG - Intronic
1073253987 10:102139379-102139401 GAGATGGCAGTGCCAGCAGCTGG + Exonic
1075773861 10:124966192-124966214 GACAGGGATGTGCTTCCAGCTGG - Intronic
1076421091 10:130332029-130332051 GCCCTGGCTTTGCCTCCAGCTGG + Intergenic
1076464288 10:130667570-130667592 GACAGGGCTGCTCCATCAGCTGG + Intergenic
1076697923 10:132256017-132256039 GACAGGGCTCTGTCCTCAGCTGG + Intronic
1077012651 11:385751-385773 GACCCGGCTGTGCCTTCAGCTGG - Intergenic
1077454911 11:2672685-2672707 GCCTTGGCTCTGCCATCAGCTGG - Intronic
1080081369 11:28222231-28222253 GCCATTGCTGAGGCTTCAGCAGG - Intronic
1080176324 11:29367163-29367185 GACATAGGTGTGTCTTCACCTGG + Intergenic
1081957579 11:47106935-47106957 CACATGGCTGTGCCTTCTTATGG + Intronic
1082080970 11:48012378-48012400 GCCATGCCTGTTCGTTCAGCAGG + Intronic
1083303027 11:61748635-61748657 GACAGGGCTGTACCTTCTCCTGG + Intergenic
1083765091 11:64837908-64837930 GACCTGGGTGTGGCTTCACCAGG + Intronic
1092197096 12:6556025-6556047 TTCATGGCTGCGCCTTCTGCTGG + Exonic
1093920153 12:24850394-24850416 GACATGGCAGGGTCTTCAGCAGG + Intronic
1094805210 12:34083689-34083711 GCCATTGCTGAGGCTTCAGCAGG + Intergenic
1096385107 12:51190173-51190195 GTCATGGCAGTGGCTGCAGCCGG + Exonic
1101832182 12:108267320-108267342 GACATGGCAGTTCATTCTGCTGG - Intergenic
1103578836 12:121899271-121899293 TTCATGGCTGTGGATTCAGCTGG + Intronic
1103679091 12:122679157-122679179 TACATGACTGTGCCTTCAGATGG - Intergenic
1105707754 13:22978942-22978964 GGCATGGCTGGGCCTTGTGCAGG - Intergenic
1106034818 13:26034147-26034169 GATCTGGCAGTGCCTGCAGCAGG + Intergenic
1106171855 13:27295429-27295451 GGGATGGCCGTGCCATCAGCGGG - Intergenic
1109067499 13:57717177-57717199 GTGATGGCTGTGCCTACAGAAGG + Intronic
1110174848 13:72543836-72543858 GACAAGGCTGTGGGTTCAGTTGG + Intergenic
1112986207 13:105453181-105453203 AACATGACTGTGAGTTCAGCAGG + Intergenic
1113299516 13:109002216-109002238 CCCAGGGCTCTGCCTTCAGCTGG + Intronic
1113879667 13:113617122-113617144 GACGTGGCTGGGCCTCCAGCAGG - Intronic
1114687212 14:24544582-24544604 GACATACATGTGCCTTCAGAGGG - Intergenic
1117528939 14:56639946-56639968 GCCATTGCTGAGGCTTCAGCAGG + Intronic
1118473306 14:66094476-66094498 GTCCCGGCTGTGCCTTCCGCCGG + Intergenic
1119526065 14:75323413-75323435 CTCATGGCTGTTCCTGCAGCAGG + Intergenic
1120006480 14:79363480-79363502 TACATGGCTGTTTGTTCAGCTGG - Intronic
1120786391 14:88541572-88541594 GACATGGATCTACCATCAGCAGG + Intronic
1121456336 14:94041077-94041099 GAGATGGCTGTGGCATGAGCAGG + Intronic
1122043674 14:99008380-99008402 CACGTGGCTGTGGCTGCAGCTGG - Intergenic
1122231645 14:100309052-100309074 GACAGGGGGCTGCCTTCAGCTGG + Intergenic
1125506728 15:40271663-40271685 GCCCTGCCTGTGCCTGCAGCAGG - Intronic
1126644529 15:50861653-50861675 CACATGGCTGGCCCCTCAGCTGG - Intergenic
1129253121 15:74319492-74319514 TACAGGGCTGGGCATTCAGCAGG - Intronic
1130700571 15:86176364-86176386 CACATGCATGTGCTTTCAGCAGG - Intronic
1131596550 15:93803789-93803811 CAGATGGCTTTTCCTTCAGCCGG - Intergenic
1131822189 15:96284603-96284625 GCCATGGCTGCGACCTCAGCTGG - Intergenic
1138037087 16:53619075-53619097 GACACGGGTGTCTCTTCAGCAGG + Exonic
1139674325 16:68512513-68512535 CACAAGACTGTCCCTTCAGCGGG + Intergenic
1141788681 16:86218326-86218348 GACATGGATGTGTCTTTTGCAGG - Intergenic
1142051849 16:87964287-87964309 GGCATGGCTGTGTTCTCAGCAGG - Intronic
1143729640 17:8873921-8873943 GACATGGCTGTGGTCACAGCAGG - Intergenic
1144238714 17:13288270-13288292 GACAAGGCTGTGAATTTAGCAGG + Intergenic
1144253916 17:13446736-13446758 AACATGGCTATGCCTTCTGAAGG + Intergenic
1144757932 17:17691549-17691571 GCCTGGGCTGTGCCCTCAGCTGG - Intronic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1146609497 17:34291693-34291715 GCCTTAACTGTGCCTTCAGCAGG + Intergenic
1149022942 17:51991300-51991322 GACATGGATGTGTTTGCAGCTGG - Intronic
1149849660 17:60027090-60027112 GACATGGCTGAGGCCACAGCTGG - Intergenic
1149860508 17:60119434-60119456 GACATGGCTGAGGCCACAGCTGG + Intergenic
1152092604 17:78255442-78255464 GACAGGGCTATGTCTCCAGCCGG + Intergenic
1152403964 17:80086092-80086114 GACCTGGCTGCGCCTGCAGCAGG + Exonic
1152416930 17:80168748-80168770 CAACTGGCTGTGCCTTCAGCCGG + Intergenic
1152763316 17:82121281-82121303 GACATGGCAGGGCCTGCATCTGG + Intronic
1152774558 17:82192694-82192716 GAGAGGGTTGTGCCCTCAGCTGG - Intronic
1154165523 18:12011676-12011698 GCCGTGGCTGTCCCTGCAGCTGG + Intronic
1155114567 18:22751847-22751869 GACATGGTGGTGGCTACAGCAGG - Intergenic
1155258336 18:24017672-24017694 GTCACTGCTGAGCCTTCAGCAGG - Intronic
1161649482 19:5475539-5475561 GTCATGGCAGGGCTTTCAGCAGG + Intergenic
1161903733 19:7139152-7139174 CACATGGCTGGGGCCTCAGCTGG - Intronic
1162194328 19:8972650-8972672 GACATGGCTGTAACCTCACCTGG + Exonic
1164311480 19:24050005-24050027 GTCATGGCACTGCCCTCAGCAGG + Intronic
1164424032 19:28124347-28124369 GACATGTCTGAGGCTACAGCAGG + Intergenic
1165307257 19:35010292-35010314 GACATGTCACTTCCTTCAGCTGG - Exonic
1165605674 19:37101798-37101820 CAGATGGGTGTGCCTTCAGCAGG + Intronic
1167683906 19:50943575-50943597 GTCAGGGCTGTCCCTGCAGCAGG + Exonic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
925350789 2:3199711-3199733 GACATGGGTGTGTCTGCATCTGG + Intronic
925350824 2:3199863-3199885 GACATGGGTGTGTCTGCATCTGG + Intronic
928107057 2:28477314-28477336 GACATGACTGAGCCTCCACCAGG - Intronic
928298610 2:30106645-30106667 GACAGGGATGTTCCTTCAGTTGG + Intergenic
929040939 2:37743769-37743791 GCCTTGGCTGCGTCTTCAGCGGG + Intergenic
930728789 2:54708810-54708832 GTCCTGGTTGTGCCTTCAGCTGG - Intergenic
933743509 2:85553300-85553322 GCCAGGGCTGCGCCATCAGCTGG - Exonic
937151892 2:119691850-119691872 GACATTGCTGTGGCAGCAGCTGG + Intergenic
938122436 2:128643486-128643508 GGCTTGGCTGTTCCTTCATCTGG - Intergenic
939592567 2:144083333-144083355 TACATGGCTGGTCCCTCAGCAGG - Intronic
944392412 2:199230398-199230420 GAGATGGCTGTGCCTTAGTCAGG - Intergenic
945301929 2:208222540-208222562 GAGATGGCTGTGCCTGGAGGTGG - Intergenic
945340119 2:208642501-208642523 GCAATGACTGTGCATTCAGCAGG - Intronic
946595955 2:221306249-221306271 GCCATAGCTGTGTCTTCAACCGG + Intergenic
947447808 2:230177921-230177943 GACATGGCTGTCAGTACAGCAGG + Intronic
1170848292 20:19980928-19980950 GAGGTGGCTGTGACTTCACCTGG - Intronic
1171141625 20:22748768-22748790 GACCTTCCTGAGCCTTCAGCTGG + Intergenic
1171213854 20:23337510-23337532 GCAATGGATGAGCCTTCAGCAGG - Intergenic
1172009555 20:31838454-31838476 GACATGGCTCAGCCTCCACCGGG - Intergenic
1172675962 20:36672430-36672452 GACATGGCTATGCCTGGAGTAGG + Intronic
1173126047 20:40336918-40336940 GACTTGGTTGTCCTTTCAGCAGG + Intergenic
1173421375 20:42904407-42904429 GACTTGGCTCTTCCTCCAGCTGG + Intronic
1174618045 20:51851561-51851583 CTCAGGGCTGTGGCTTCAGCGGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1177212017 21:18083181-18083203 GCCATGGCTGTTGCTTCAGAGGG + Intronic
1178244217 21:30936025-30936047 GTCCTGGCTGTGCCTTTGGCCGG - Intergenic
1180865337 22:19115436-19115458 GACATGGCTGTGGAGCCAGCTGG - Intronic
1181865714 22:25853374-25853396 GACAAGGCAATGCCTTCTGCAGG + Intronic
1184358615 22:43999551-43999573 GACGTGGGTGTTCCTGCAGCTGG + Exonic
1184781600 22:46652373-46652395 GGCAGGGCTGTTCCTTCTGCAGG - Intronic
1184865709 22:47200887-47200909 GACATGCCGGTGGCTGCAGCGGG + Intergenic
950097948 3:10340843-10340865 GCCAGGGCTGTGCTGTCAGCTGG + Intronic
951718627 3:25674631-25674653 GTCCCGGCTGCGCCTTCAGCCGG + Intergenic
953188896 3:40664998-40665020 GACAAGGCTGTGTCTTCTGTAGG - Intergenic
955632122 3:60985856-60985878 GACAGGGCTGTTCCTTCTGGAGG + Intronic
956454870 3:69410565-69410587 GCCATGCCTGTGCCATCAGAGGG - Intronic
960689995 3:120336313-120336335 CAAAGGGCTGTGACTTCAGCTGG + Intronic
961645770 3:128392069-128392091 CACATAGCTCTGCCCTCAGCTGG - Intronic
961959486 3:130839590-130839612 GAGCTGGCTGTGCTTTCAGAAGG + Intergenic
963593009 3:147286618-147286640 GATGTGGCTGTGGCTTCAGGGGG - Intergenic
966299919 3:178466746-178466768 CACATTGCTTTGCCTTCTGCAGG + Intronic
968968437 4:3781229-3781251 CACATGTCTATGCCCTCAGCAGG + Intergenic
969255136 4:5996266-5996288 GAGAAGGCTTTGCCTGCAGCAGG - Intergenic
971310310 4:25520556-25520578 GACATGGCTCTAGCTGCAGCAGG - Intergenic
973716279 4:53680182-53680204 GACATGACTGTGCCACCAGCTGG + Intronic
975254509 4:72216946-72216968 GTCCTGGCTGTGCCTTTGGCTGG + Intergenic
978402983 4:108350283-108350305 TCCATGGCTCTTCCTTCAGCTGG + Intergenic
979661270 4:123258545-123258567 AAAATGGCTGTGTCTACAGCAGG - Intronic
980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG + Intergenic
981305423 4:143242021-143242043 GAAATGGCTGTGCTTTAATCAGG + Intergenic
1202762714 4_GL000008v2_random:125944-125966 TACAAGGCTGTGCCTGTAGCAGG - Intergenic
985573996 5:665357-665379 GAAATGGCTGTGCCCTGGGCAGG + Intronic
985862887 5:2488192-2488214 GACCAGGCTGAGCCTCCAGCAGG + Intergenic
989094790 5:37771837-37771859 GTCATGGCTTTGCCTTTTGCAGG - Intergenic
989618660 5:43363347-43363369 GACATGGCTCTGCCCTCACGGGG + Intergenic
991185645 5:63803626-63803648 AACACAGCTGAGCCTTCAGCTGG - Intergenic
995633805 5:114162680-114162702 GCCATTGCTGAGGCTTCAGCAGG - Intergenic
996341514 5:122443987-122444009 GACATGTCTGTGGATTGAGCAGG - Intronic
996593920 5:125179692-125179714 GACATGGCAATGCCTGCAGGAGG + Intergenic
998055350 5:139071449-139071471 GACTTGGGTGTGACTTCACCTGG + Intronic
999231346 5:150063858-150063880 AGCTTGGCTGTGCCTGCAGCTGG + Intronic
1002467168 5:179413367-179413389 GACATGGCTGGGCCCTCACTCGG - Intergenic
1002519681 5:179784946-179784968 GAGATGGCTGTGAGATCAGCAGG - Intronic
1003173912 6:3740856-3740878 GCAATGACTGTGCCTTCACCTGG + Intronic
1004471171 6:15930758-15930780 AAGATGTCTGTGGCTTCAGCTGG + Intergenic
1006212782 6:32411614-32411636 GATTTGGCTCTGCCTTCAACTGG - Intergenic
1007382367 6:41499103-41499125 GACGGGGCTGTGGCCTCAGCTGG - Intergenic
1009947023 6:70351986-70352008 GCCATGGCTGCCCCATCAGCAGG + Intergenic
1011850610 6:91623525-91623547 CTCATGGCTGTGCCTTCACTTGG + Intergenic
1012801288 6:103832542-103832564 GGCATGGCTTTGACTACAGCAGG - Intergenic
1015276558 6:131388460-131388482 GACCTGGGTGTGCTGTCAGCTGG - Intergenic
1015808881 6:137141611-137141633 GACAGGGCTGTGGCTACTGCCGG - Intergenic
1017116639 6:150983618-150983640 GACATGGCTGTGCAGTCCCCAGG + Intronic
1017946983 6:159103975-159103997 GACAGGGCTGTGCCTGCAAATGG + Intergenic
1018073864 6:160191809-160191831 CACATGCCTGTGCCCCCAGCCGG + Intronic
1019510312 7:1414379-1414401 CACCTGGCTGTGCCCCCAGCTGG + Intergenic
1020128367 7:5545732-5545754 GACCGGGCTGTGTCCTCAGCAGG - Intronic
1021097064 7:16547153-16547175 TTCCTGGCTGTGTCTTCAGCTGG - Intronic
1023638287 7:42235697-42235719 TACATGGCAGTGCCATTAGCCGG - Intronic
1025149971 7:56540161-56540183 GACCTGCCTGTGCCTCCTGCTGG + Intergenic
1026236145 7:68528882-68528904 GATAGGGATGTTCCTTCAGCTGG + Intergenic
1031458344 7:122012239-122012261 GGCATGACTGTGCTTTCAGAAGG - Exonic
1032085572 7:128881698-128881720 GACATGGCTCTGCATCCACCAGG - Exonic
1032268731 7:130385419-130385441 GAGGTGTCTGTGCCTTAAGCAGG - Intronic
1032964191 7:137076783-137076805 GACTTGGCTGTACCATCAGATGG - Intergenic
1033243394 7:139699585-139699607 GGCAAGGCTGGGCCTGCAGCTGG + Intronic
1035065325 7:156100167-156100189 GACTTGGCTGAGCCGTCAGCCGG - Intergenic
1035460497 7:159035659-159035681 GACATCGCTGTGCCCACCGCAGG + Intronic
1036434783 8:8723345-8723367 GGCGTGGCTGGGCCTTCTGCAGG - Intergenic
1037159483 8:15750803-15750825 GAGATAGATTTGCCTTCAGCAGG + Intronic
1039995902 8:42532887-42532909 GACTTGGGTGTGCCTTCCTCTGG - Intronic
1042337215 8:67640882-67640904 ATTCTGGCTGTGCCTTCAGCAGG + Intronic
1043926320 8:86040919-86040941 CACATGGCTGTGCCCTGAGCTGG + Intronic
1048458651 8:134601722-134601744 AACATGGCTGTGCTTTCAGCTGG - Exonic
1048662225 8:136617944-136617966 GACATTGCAGTGCCTCCAACTGG + Intergenic
1049438674 8:142599313-142599335 GACAGGGCTGTGCCCTGAGTGGG + Intergenic
1050207772 9:3215291-3215313 ATCATGGCTGAGCCTTTAGCAGG - Intergenic
1057277798 9:93685346-93685368 TACATGTCTGTGCCTCCAGGGGG + Intergenic
1059277366 9:113107949-113107971 GAGGTGGCTCTGCCTGCAGCTGG - Intergenic
1059278885 9:113116602-113116624 GAGGTGGCTCTGCCTGCAGCTGG + Intergenic
1060939486 9:127535397-127535419 GACATGCCTGGGCCTTCTCCTGG - Intronic
1060965793 9:127711752-127711774 GGCCTGGCTGTGTCTGCAGCTGG + Intronic
1061765284 9:132877898-132877920 GTCCTGGCTGTGCCGCCAGCGGG - Intronic
1062436597 9:136549167-136549189 GGCCTGGCTGGGCCTTGAGCTGG - Intergenic
1062703179 9:137918716-137918738 GATAGGGCTGGGCATTCAGCAGG + Intronic
1062730436 9:138105415-138105437 GAGGTGGCTGTGCTTTCAGAGGG + Intronic
1188392621 X:29640030-29640052 GACATCACTGTGGCTACAGCTGG + Intronic
1188712329 X:33415888-33415910 GCCATGGCTGTGTCTGTAGCAGG - Intergenic
1189004689 X:36983559-36983581 CACATGGCTTTGCCCTCAGTAGG - Intergenic
1190217252 X:48488168-48488190 GACAGGGCTGTGCCCTCCCCTGG - Intergenic
1192579469 X:72269110-72269132 TACATCCCTGTGCCTCCAGCAGG - Intronic
1195375282 X:104220779-104220801 GACAGAGCTGTGCCTACAGTGGG - Intergenic
1196178223 X:112663455-112663477 GACATGGAAGTCCCTTCAGAAGG - Intronic