ID: 1072546369

View in Genome Browser
Species Human (GRCh38)
Location 10:96442505-96442527
Sequence CAGGGCAGTCCTGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072546369_1072546376 29 Left 1072546369 10:96442505-96442527 CCTTCCTCTTCAGGACTGCCCTG 0: 1
1: 0
2: 3
3: 42
4: 349
Right 1072546376 10:96442557-96442579 GTAATGCAGAGTGAAGGGACTGG No data
1072546369_1072546375 24 Left 1072546369 10:96442505-96442527 CCTTCCTCTTCAGGACTGCCCTG 0: 1
1: 0
2: 3
3: 42
4: 349
Right 1072546375 10:96442552-96442574 CTGCTGTAATGCAGAGTGAAGGG No data
1072546369_1072546374 23 Left 1072546369 10:96442505-96442527 CCTTCCTCTTCAGGACTGCCCTG 0: 1
1: 0
2: 3
3: 42
4: 349
Right 1072546374 10:96442551-96442573 GCTGCTGTAATGCAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072546369 Original CRISPR CAGGGCAGTCCTGAAGAGGA AGG (reversed) Intronic
900268735 1:1775641-1775663 CTGGGCAGTTCTGAATGGGAAGG + Intronic
900638841 1:3678734-3678756 CAGGGGAGTCATGAAGAGCCTGG - Intronic
900996908 1:6127820-6127842 CAGGGCCGCCCTGCAGAGGCCGG + Intronic
902118313 1:14140138-14140160 CAGGGTAGTCCTTAAAGGGAAGG + Intergenic
904534260 1:31188689-31188711 AAGGGCACTACTGAAGAGCATGG - Intronic
905447844 1:38038895-38038917 CTGGGCTGGCCTGGAGAGGAGGG - Intergenic
905638908 1:39575673-39575695 CAGGGCCCTCCTGCCGAGGAGGG - Intronic
906246918 1:44282839-44282861 CTGTGCTGACCTGAAGAGGAAGG - Intronic
907145035 1:52223873-52223895 CATGGCAGCCCTGAAGATCATGG + Intronic
907593617 1:55699559-55699581 CAAAGCAGTCCTGAAAGGGAGGG + Intergenic
909924944 1:81427782-81427804 TATGGCAGTCCTGAACAAGAAGG - Intronic
911808146 1:102237376-102237398 TAGGGGAGTCTTGAAGAAGAAGG + Intergenic
913570596 1:120116034-120116056 CATGGCTGTCTTTAAGAGGATGG - Intergenic
914291403 1:146277013-146277035 CATGGCTGTCTTTAAGAGGATGG - Intergenic
914335981 1:146715270-146715292 CAGGGCAATGCTCCAGAGGAAGG + Intergenic
914552447 1:148727796-148727818 CATGGCTGTCTTTAAGAGGATGG - Intergenic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
915588358 1:156857354-156857376 CAGGGGAGCCCTGGAGAGGCAGG - Intronic
915625090 1:157109550-157109572 CAGGGCCTTCCTGAAGAGGAGGG - Intergenic
917957925 1:180119215-180119237 CAGTCCAGTCCAGAACAGGAAGG + Intergenic
918160115 1:181890159-181890181 CAGGCCAGTGCTCCAGAGGAAGG + Intergenic
919168142 1:193920679-193920701 TAGGGCAGTTCTGAAGCAGATGG + Intergenic
919780676 1:201218753-201218775 CGGGGCAGTCCTGAGGGAGATGG + Intronic
919911351 1:202112920-202112942 CAGGGCAGAGCCAAAGAGGAGGG - Intergenic
920055014 1:203185154-203185176 CAGGGCTGGCCAGGAGAGGAGGG - Intronic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920661812 1:207921762-207921784 TAGGGAAGACCAGAAGAGGAGGG - Intergenic
921070569 1:211654773-211654795 GAGGGCAGTCCTGAATGAGATGG + Intergenic
921922463 1:220685165-220685187 AAGGGCAGTCCTGCAGATGTTGG + Intergenic
922131832 1:222787604-222787626 CAAGGGCGTCCTGAGGAGGACGG - Intergenic
924863482 1:247952226-247952248 GAGGCCAGTCCTGAGAAGGATGG + Intronic
1062952276 10:1513618-1513640 CAGGGCAGCCCTGAGGAGAGGGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1062978604 10:1703277-1703299 CAGGGAACACCTGATGAGGAGGG + Intronic
1063285658 10:4684945-4684967 CAGAGCAGCCCTGAAGAGCAGGG + Intergenic
1063608938 10:7546805-7546827 CAGGCAAGTCCTGGAGAGGGAGG + Intergenic
1063611281 10:7563817-7563839 CAGGAGAGTCCTGAGGACGAGGG - Intronic
1064265369 10:13821250-13821272 CAGGGCTGTGCTGGAGAGGCAGG - Intronic
1065428157 10:25627312-25627334 TATGGCTGTCCTGAAGAGGAAGG - Intergenic
1065893970 10:30145187-30145209 CATGGGAGACCTGCAGAGGAGGG + Intergenic
1066454520 10:35561309-35561331 CAGGGCAGCCCTTGATAGGATGG - Intronic
1067031217 10:42879683-42879705 CAGGGCAGGGCTGAAGTGCAGGG + Intergenic
1067293841 10:44963113-44963135 CAGGGGAGTCCAGGAGAGGCGGG - Intronic
1067684029 10:48456700-48456722 CCGGGCAGGTCTGCAGAGGAGGG - Intronic
1067726215 10:48773224-48773246 GAGGGCAGTTCTGCAGAGAAGGG + Intronic
1067774467 10:49152964-49152986 CTGGGCAGACCTGAAGATGCAGG - Intergenic
1067807596 10:49404060-49404082 GAGGGCAGTCCTGGAGAGGTGGG - Intergenic
1067837698 10:49651740-49651762 CAGTGCACTCCTGAAGGGCAGGG + Intronic
1069586308 10:69605381-69605403 CATTGGAGTCCTGAAGAGAAGGG + Intergenic
1069799101 10:71071266-71071288 CAGGGCAGGCCTGAAGAACCGGG + Intergenic
1069885894 10:71623396-71623418 CAGGACAGAGCTCAAGAGGATGG + Intronic
1070087413 10:73250713-73250735 CAGGCCAGGCCAGAAGAGCAAGG + Exonic
1070812184 10:79303958-79303980 CAAGACAGTCCTGCAGAGGTAGG - Intronic
1071332541 10:84574383-84574405 CATGGCAGTCCTGGGGAGAAAGG - Intergenic
1072546369 10:96442505-96442527 CAGGGCAGTCCTGAAGAGGAAGG - Intronic
1073677398 10:105663646-105663668 CAGAGAAATCCTGAAGTGGAGGG - Intergenic
1074455489 10:113592218-113592240 CCGGGCAGTCTGGAAGGGGATGG + Exonic
1074467622 10:113697506-113697528 CAGGGCTGTATTGAAGAGCAGGG + Exonic
1074547585 10:114413299-114413321 GAGGGCATTCCAGAAGGGGAAGG - Intergenic
1074564512 10:114565111-114565133 CAGGGAACTGCTGAAGAGTAGGG - Intronic
1075705322 10:124497153-124497175 CAGGGGAGCCCAGAATAGGAAGG - Intronic
1075753361 10:124791757-124791779 AAGGGCAGTCCCGGGGAGGACGG - Exonic
1075787581 10:125060645-125060667 CAGGGCAGTCATGCGGAAGAGGG + Intronic
1076583824 10:131532221-131532243 CAGGGCGGTCCGGGAGAGGGAGG - Intergenic
1077234328 11:1472615-1472637 TGGGGCAGTGCTGAAAAGGATGG + Intronic
1078935507 11:15945888-15945910 CAGGGCACTCCTGAAGGCCAAGG - Intergenic
1080779657 11:35418982-35419004 CCGGATAGTGCTGAAGAGGAGGG - Exonic
1083588267 11:63876241-63876263 CAGGAGAGTCCTGAAGTTGAAGG - Intronic
1084270246 11:68025667-68025689 CAGGGCAGTACTGGACAGTAGGG - Intronic
1084468260 11:69339925-69339947 CAGGGCATTAGGGAAGAGGATGG + Intronic
1085251705 11:75148207-75148229 CAGGACAGGCCTGAGGTGGAGGG + Intronic
1088182696 11:107129941-107129963 CAGCACAGTCCAGAGGAGGAAGG + Intergenic
1089810623 11:121128405-121128427 AAAGGCAAACCTGAAGAGGATGG - Intronic
1090085858 11:123650547-123650569 AAGGGCAGGCCTGGAGAAGAAGG + Intronic
1090436815 11:126693977-126693999 CTGGGCAGGCCAGTAGAGGAAGG + Intronic
1090605601 11:128420406-128420428 CCAGGCAGACCTGAGGAGGATGG - Intergenic
1090797214 11:130145550-130145572 CAGGAAAGCCCTGAAGAAGAGGG + Intergenic
1091136229 11:133192717-133192739 CACAACAGTCCTGAACAGGAGGG - Intronic
1092533132 12:9361647-9361669 CAGAGCACACCTGAAGCGGAGGG - Intergenic
1094694932 12:32809071-32809093 CTGGGCAGTCCAGATGAGGAAGG - Intronic
1096175265 12:49511248-49511270 TAAGGAAGTCCTGAAAAGGAAGG + Intronic
1096464577 12:51841169-51841191 CAGGGCTGTCCTCAAGGGGGTGG + Intergenic
1098850580 12:75591423-75591445 CAGGGCACTGCTGAAGTCGAGGG + Intergenic
1099760882 12:86919003-86919025 CAGGGCAATCATGCAGAAGAAGG + Intergenic
1100217754 12:92470056-92470078 CAAGGGAGTCCGGAAGAGGAGGG - Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101814231 12:108133591-108133613 CAGTTCAGTCCTGAGGAGCAGGG - Intronic
1101828883 12:108241959-108241981 CAGCGCAGTGCTGAAGAGCGTGG - Intronic
1102353929 12:112216438-112216460 CAGGGAAGTGGTGAAGTGGAGGG + Intronic
1102385275 12:112503845-112503867 CAGAGCAGTCCAGGAGAGTAAGG - Intronic
1102532083 12:113554073-113554095 CAGAGCAGGACAGAAGAGGAGGG - Intergenic
1103926531 12:124426556-124426578 CAGCGCAGGCCTCAACAGGATGG + Intronic
1104582877 12:130023641-130023663 GGGGGCATTCCTGAAGAGGGAGG + Intergenic
1104768748 12:131346788-131346810 CAGGGCAGGCATTTAGAGGAAGG - Intergenic
1106308902 13:28535530-28535552 CAGGGCAGTCCTGAAGCCTGGGG + Intergenic
1108750949 13:53447802-53447824 TAGGGCAAACCCGAAGAGGAAGG - Intergenic
1111064507 13:83072872-83072894 TAGGGCAGTGCAGAAGAGAAAGG + Intergenic
1114525876 14:23366488-23366510 CAGCGGAGTCCGGAGGAGGAAGG - Intergenic
1114635132 14:24182975-24182997 CAAGGCTGTGCTGCAGAGGAAGG - Exonic
1115843939 14:37504755-37504777 CAGAGCAGAACTGAAGAAGATGG + Intronic
1117255207 14:53970271-53970293 CAGTGCAGTGATTAAGAGGATGG - Intergenic
1118990343 14:70791827-70791849 CAGGGAGCTCCTGGAGAGGAGGG + Intronic
1119388198 14:74272027-74272049 GAGGGCAGAGATGAAGAGGAAGG - Intergenic
1119688656 14:76653420-76653442 CAGGGCAGGCCTGGAGCCGATGG - Intergenic
1120588651 14:86348131-86348153 CACTGCAGTCATGAAGATGAGGG - Intergenic
1121109219 14:91301007-91301029 CAGTGGAGTCCTGAAGAGAAAGG - Intronic
1122786966 14:104168368-104168390 CAGGGCTGCCCTGGAGAGGTTGG - Intronic
1124291975 15:28460394-28460416 CAGTGAAGTCCAGAAGAGGTTGG + Intergenic
1124972309 15:34500106-34500128 GAGGGAAGTCATCAAGAGGATGG + Intergenic
1126101214 15:45119356-45119378 CACAGCAGTCCTGGAGATGAGGG + Exonic
1126210451 15:46095233-46095255 AAGGGAAGTGTTGAAGAGGAAGG + Intergenic
1126379241 15:48029165-48029187 GAGGACAGCCCTGAAGAGGTTGG - Intergenic
1126915929 15:53466383-53466405 CTGGTCAGTCCTTCAGAGGATGG + Intergenic
1127651094 15:61008473-61008495 CAGGTCAGCCCTGAGGAAGAGGG + Intronic
1128795739 15:70465242-70465264 CAGGGCAGTTCTGAAGACTAAGG + Intergenic
1129157010 15:73724503-73724525 CAGGGATGCCCTGGAGAGGAAGG - Intergenic
1130516553 15:84630318-84630340 CATTGCATTCCTTAAGAGGAAGG + Intergenic
1130779238 15:87017221-87017243 CTGGACAGTCCAGATGAGGAAGG + Intronic
1131590873 15:93747033-93747055 CCAGGCAGTCCAGAAAAGGAGGG + Intergenic
1132104952 15:99056810-99056832 CAGGGCAGTCCCTGAGATGATGG + Intergenic
1132749438 16:1450704-1450726 CAGGGCAGTCCTGCGGAGGCGGG - Intronic
1133225629 16:4339044-4339066 AAGGGCAGTCCGGGAGAGGGTGG - Exonic
1134044526 16:11091501-11091523 CAGGACAGCCCTGCAGAGGTGGG - Intronic
1134096837 16:11423948-11423970 CCGCGCAGCCCTGGAGAGGAAGG - Intronic
1134741966 16:16555612-16555634 CAGGGCAGTCCCAATGAGTAAGG - Intergenic
1134854917 16:17510451-17510473 CAGGCCAGTCCTGATGAGAGAGG - Intergenic
1134925592 16:18156844-18156866 CAGGGCAGTCCCAATGAGTAAGG + Intergenic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1135541119 16:23331122-23331144 CAGGGCTGTGTTGAAGAGGGTGG + Intronic
1136605950 16:31333845-31333867 CAGGGCAGGCCAGAAGTGGTAGG - Intergenic
1137670007 16:50273357-50273379 CAGGGCAGGGCAGAAGGGGAAGG - Intronic
1137720470 16:50624810-50624832 CAGGGCAGCCCTGAAGAGCCTGG - Intronic
1138290511 16:55842633-55842655 CAGGGCAGAGCTGCAGGGGAGGG - Intergenic
1138497438 16:57416775-57416797 CAGGGCAGTCCCTAAGAGCTGGG - Intergenic
1139594149 16:67948408-67948430 CAGGGCAGAGCTGAAGAGGGTGG + Intronic
1139997643 16:70995953-70995975 CAGGGCAATGCTCCAGAGGAAGG - Intronic
1141192202 16:81833024-81833046 AAGGGAAGTCCAGAAGCGGAAGG + Intronic
1142054025 16:87980747-87980769 CAGGGCAGCCCCGCAGAGCATGG + Intronic
1143499893 17:7332464-7332486 CATGGCAATCCTGAAGGGGCAGG - Intergenic
1144212250 17:13025571-13025593 CATGGCAATCCTGGAGAGCAAGG - Intergenic
1144418469 17:15073643-15073665 CTGGGAGGTCCTGGAGAGGAAGG + Intergenic
1144440820 17:15279711-15279733 CATGTCAGTCCTGAAGAGGGAGG - Intergenic
1145056779 17:19708184-19708206 CTGTGCCGTCCTGAAGTGGAGGG - Intronic
1145921097 17:28610738-28610760 CAGGACAGGCCTGAACAGAAAGG + Intronic
1146534062 17:33634312-33634334 CAGGGCAGGCTAGGAGAGGATGG - Intronic
1148205212 17:45775586-45775608 CAGCTCATTCCAGAAGAGGAAGG - Intergenic
1148729898 17:49827619-49827641 CAGGACAGTCCTGAGGGGGATGG - Exonic
1148844068 17:50518408-50518430 CTCTGGAGTCCTGAAGAGGAGGG + Intronic
1150269607 17:63855129-63855151 CAGGGCAGTCCTGGGGCAGAAGG - Intergenic
1150578782 17:66453619-66453641 CAGGGCAGTTCTAAAGATCAGGG - Intronic
1151193412 17:72414945-72414967 CAGCACATTTCTGAAGAGGAAGG + Intergenic
1151209420 17:72533263-72533285 CAGGCCACTCCCGAGGAGGAAGG - Intergenic
1151627463 17:75286193-75286215 CAGGGCAGGACGGAAGAGGCAGG - Intronic
1151678173 17:75610509-75610531 CAGGGGAGGCCTGGAGGGGATGG - Intergenic
1151798989 17:76366391-76366413 GAGGGCTGTCCTGTGGAGGAAGG + Intronic
1151840977 17:76617162-76617184 CAGGGCAGTTCTGAAGCGGCAGG - Intergenic
1152214440 17:79024339-79024361 GACGGCAGTGCAGAAGAGGAGGG - Exonic
1155440001 18:25852185-25852207 CAGGGCAGTCCTCCTGAGAAGGG + Intergenic
1155506300 18:26536574-26536596 CAGGTCAGCCCTGGAGAGTAAGG - Intronic
1157680295 18:49600195-49600217 GAGGGGAGCCCTGATGAGGAAGG + Intergenic
1158455870 18:57607145-57607167 CAGAGCAGTCCAGAACACGAAGG - Exonic
1160489542 18:79325680-79325702 CTGGGCAGCCCTGAAAAGGAGGG + Intronic
1160882582 19:1328266-1328288 CAGGGCTGTACAGAAGAGGGTGG + Intergenic
1160950612 19:1665545-1665567 CAGGGCAGTCCTGCCCGGGAAGG + Intergenic
1161079798 19:2305128-2305150 CATTGCAGTCTTGAAGAGGGAGG + Intronic
1161089980 19:2354892-2354914 CCTGGCTGTCCTGCAGAGGACGG + Intergenic
1161759179 19:6158543-6158565 CAGGAGGGTCCTGGAGAGGAGGG + Intronic
1162947874 19:14054638-14054660 CAGGGCAGCCCTGAGGGTGATGG - Exonic
1163239632 19:16052565-16052587 CAGGGCATTCCTGAATGCGAAGG - Intergenic
1164417771 19:28060688-28060710 CAGGGCAGGGCCGAATAGGATGG - Intergenic
1164808580 19:31138366-31138388 GAGGGCAGTCCTCCAGAGGAGGG - Intergenic
1165871547 19:38976308-38976330 CAGGGGAGTCCTAAGGTGGAAGG - Intergenic
1165992156 19:39822570-39822592 CAGGAGAGACCTAAAGAGGAAGG + Intergenic
1166890121 19:45986431-45986453 CAGGGCAGTCCAGAAGGGCTTGG + Intergenic
1167494350 19:49809042-49809064 GAGCGCAGTCCAGAAGAGGCGGG + Intronic
1168203921 19:54835560-54835582 CAGGGTAGACATGAAGTGGAGGG - Intronic
1168626442 19:57921918-57921940 CAGGGCAGTCCAGGAGCGGCAGG + Exonic
1168669487 19:58229807-58229829 CAAGGCAGTGCTAATGAGGAAGG + Intronic
1168713499 19:58514503-58514525 AAGGGAGGTCCTGGAGAGGAGGG - Intronic
925131599 2:1497537-1497559 CAGGGCAGTTCTGAAGTAGTTGG - Intronic
925338277 2:3114747-3114769 CTGGACACTGCTGAAGAGGAGGG + Intergenic
925352589 2:3211922-3211944 CAGGGGAGGCCTGGAGTGGAAGG - Intronic
927913612 2:26919019-26919041 CAGGGCAGTCCTGTAGAAGATGG + Intronic
927915498 2:26933470-26933492 CAGGGCAGCTCTGAGGAAGACGG - Intronic
928365937 2:30702940-30702962 AAGGGAAGTCCTGAAGCTGATGG - Intergenic
928417393 2:31107411-31107433 AAGGGCTGTCCTGAGCAGGAGGG - Intronic
928913239 2:36444072-36444094 CAGGGTCTTCCTGAAAAGGAAGG + Intronic
932014349 2:68009285-68009307 GAGGGCAGGCCTGAAAAGCAGGG - Intergenic
932712397 2:74076790-74076812 CAGAGCAGTCCTGAAGAGAAAGG - Intronic
935093834 2:99924598-99924620 GAGGGCTGTCATGAGGAGGAGGG + Intronic
935146487 2:100398990-100399012 GAGGGCATTCCTGAATAGCAGGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
938100242 2:128493383-128493405 CCGGGCCGCCCTGCAGAGGAAGG + Intergenic
939111372 2:138011967-138011989 CAGGGCAGTAATAAAGAGCATGG - Intronic
939351238 2:141040758-141040780 CAGGGCAATTCTGAAGATGCTGG + Intronic
939460177 2:142488754-142488776 CAGGGAACTCATGAAGAGGGTGG - Intergenic
939702710 2:145413531-145413553 TAGGTCCTTCCTGAAGAGGAAGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942002450 2:171662351-171662373 CACAGAATTCCTGAAGAGGAAGG - Intergenic
942140432 2:172972137-172972159 CAAGGCTGTCCTGCAGAGGCTGG + Intronic
943373347 2:187044520-187044542 CAGGGCAGTACCAAAGGGGATGG - Intergenic
943571537 2:189580858-189580880 CCGGGCGGCCCTGAAGGGGACGG - Exonic
944033971 2:195270095-195270117 CAGCTCAGACCTTAAGAGGATGG + Intergenic
944466468 2:200005421-200005443 CAGTGATTTCCTGAAGAGGAGGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945935624 2:215900253-215900275 CAGAGCAGTCTTGCAGAGGCTGG + Intergenic
946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG + Intergenic
947108935 2:226697834-226697856 CAGGGAAGGCCTCAATAGGAGGG + Intergenic
947542783 2:230990353-230990375 CAGGGCACCCCAGGAGAGGAAGG + Intergenic
948353780 2:237361155-237361177 CAGGGTATTCCTGGAGAAGACGG - Exonic
948542168 2:238698888-238698910 CAGGGCAGTCATGGAGATGAAGG - Intergenic
948881037 2:240857318-240857340 CAGGTCAGTCCTGCCCAGGAGGG + Intergenic
948922008 2:241070252-241070274 CAGGTCAGTCCTGAACAGGGTGG - Intronic
948924509 2:241086353-241086375 TGGGGCAGTACTGAAGAGGAGGG - Intronic
1171138419 20:22719409-22719431 CAGGGCGGTCCCTCAGAGGAAGG + Intergenic
1171167000 20:22980898-22980920 CAGAGCAGAGCAGAAGAGGATGG - Intergenic
1171461692 20:25301646-25301668 CAGGGCAGTACAGAGGAGGCCGG + Intronic
1172096353 20:32462393-32462415 CAGCTCAGTCCTGAGGAGGCTGG + Intronic
1172127003 20:32630423-32630445 CCTGGCACTACTGAAGAGGACGG - Intergenic
1172508131 20:35479311-35479333 CAGGGCAGTCCAGGAGAAGGAGG + Exonic
1172940553 20:38650942-38650964 CAGGGCAGAGGAGAAGAGGAAGG - Intronic
1173017921 20:39243783-39243805 CATGGAAGTCCTGAAGAGCAAGG + Intergenic
1173593299 20:44241902-44241924 CAGGGCAGGCCTGAAGTGCCAGG + Intergenic
1173620233 20:44430731-44430753 CACAGCAGTTCTGCAGAGGACGG + Exonic
1174037240 20:47675760-47675782 CAGGGCAGGCTTGGAGAGGAGGG - Intronic
1174237298 20:49104438-49104460 CAGCCCAGCTCTGAAGAGGAGGG + Intergenic
1175036963 20:56008611-56008633 CAGGTCAGTCGTGCAGAAGATGG + Intergenic
1175327884 20:58142279-58142301 AAGGTCAGTCTTGAAGAGTAAGG + Intergenic
1175514712 20:59561637-59561659 TATGGCAGTCCTCAAGAGCATGG - Intergenic
1176000316 20:62828695-62828717 CAGGGCAGGACTGTAGAGGGAGG + Intronic
1176062011 20:63176579-63176601 CTGGGCAGTGCTGGAGAGGGTGG + Intergenic
1176520025 21:7817548-7817570 CTGGGCATTCCTGAAGAGTATGG - Exonic
1177829683 21:26124045-26124067 CAGGCCAGTGCTAAAGAGTAGGG - Intronic
1178227502 21:30740110-30740132 CAGTGCTGTGCTGAAGAGGCTGG + Intergenic
1178654053 21:34447561-34447583 CTGGGCATTCCTGAAGAGTATGG - Intergenic
1178845899 21:36173963-36173985 CAGAGCAGCCATGAACAGGAAGG + Intronic
1179137822 21:38696169-38696191 CATGGCAGAGCTGAGGAGGAAGG + Intergenic
1180061911 21:45389984-45390006 TAGGACACTTCTGAAGAGGAAGG - Intergenic
1180205471 21:46256749-46256771 CAGGGGAGCCCTGACGAGGCAGG + Intronic
1180700740 22:17780300-17780322 CAGGGCAGAGGTCAAGAGGAGGG + Intergenic
1180850737 22:19018801-19018823 GAGGGCCCTCCTGAAGAGGGGGG - Intergenic
1181480779 22:23197959-23197981 CAGGCCAGGAATGAAGAGGAAGG + Intronic
1181490036 22:23255904-23255926 CAGAGCTGGTCTGAAGAGGAGGG + Intronic
1181768099 22:25106353-25106375 AAGGGCAGTTCTCCAGAGGAGGG + Intronic
1181943721 22:26498966-26498988 AAGTGCAGTCCTGAGGAGAAAGG + Exonic
1182229913 22:28829909-28829931 CAGGACTGTTCTGAAGATGAAGG + Intergenic
1182490898 22:30671067-30671089 CAGTGCAGTCCACAAGAGAAGGG - Intergenic
1184095703 22:42315160-42315182 CAGGGCAGTCCTGACAGGGGAGG + Intronic
1184391141 22:44204365-44204387 CATGGCAGCCTTGGAGAGGAAGG + Intronic
1184571952 22:45330831-45330853 CAGGGCCGACCTGAAGGGCACGG - Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184784917 22:46666994-46667016 CTGGCCTGGCCTGAAGAGGAGGG + Intronic
1185140900 22:49100725-49100747 CAGGGGTGTCCAGAAAAGGAGGG - Intergenic
952851353 3:37732444-37732466 TAGGGCAGTCCTGGTGAGGTGGG - Intronic
952935607 3:38396250-38396272 CAGGGCAGTGCAGAGGAAGAAGG + Intronic
953916062 3:46922006-46922028 CAGGCCTGTCCTGCAGAGGATGG - Exonic
954135552 3:48580588-48580610 CAGGGAGATCCTGGAGAGGATGG - Exonic
954163854 3:48740510-48740532 CAGTGCAGTTCTGCAGAGGGAGG + Intergenic
955485218 3:59428143-59428165 CAGGGAAGACCCGATGAGGAAGG - Intergenic
955751720 3:62190278-62190300 CAGGACAGTCCCCAAGAGCAAGG + Intronic
956759952 3:72432413-72432435 CAGGGCAGTGGTGCAGTGGAAGG - Intronic
961870679 3:129985509-129985531 CAGGGCAGCCCTGGAGATCATGG + Intergenic
963503774 3:146160747-146160769 CCCGGCGGTCCTGGAGAGGAGGG + Intronic
964880300 3:161416447-161416469 CAGGCAAGTCCTGGACAGGAAGG + Intergenic
967855206 3:194112277-194112299 CAGGGCTTTCCTGCAGGGGAGGG - Intergenic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
969561446 4:7950686-7950708 CTGGGCTGTCCTGAGGAGGATGG - Intergenic
970413961 4:15838259-15838281 CAGGTCAGTTCTGAAGATTAGGG + Intronic
971194175 4:24456228-24456250 CATTGAAGTCCTGGAGAGGATGG + Intergenic
974834266 4:67228443-67228465 CAGGGCCCTCCAGAAGAGCAAGG + Intergenic
976217867 4:82731668-82731690 CAGCGCAGTTCTTATGAGGATGG + Intronic
977200876 4:94114123-94114145 CTGATCGGTCCTGAAGAGGATGG + Intergenic
977903802 4:102453431-102453453 ACAGGCAGTCCTGAAGAAGATGG + Intergenic
980469644 4:133234402-133234424 CAGGACTGCCCTGTAGAGGAAGG - Intergenic
985034025 4:185820494-185820516 CAGGGCTGGCCTTCAGAGGAGGG + Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985262994 4:188132144-188132166 CAAGTCAGTCTTGAAAAGGAAGG - Intergenic
986026639 5:3857562-3857584 CAGGGCAGTTCAGCAGAAGACGG + Intergenic
987942869 5:24564875-24564897 CAGGGCAGCCTTGCACAGGAGGG - Intronic
988497265 5:31756094-31756116 AAGGTCAGTCATGATGAGGAAGG + Intronic
992522770 5:77573106-77573128 CAGATCTGTCCTGGAGAGGAAGG - Intronic
994643099 5:102434774-102434796 TGGGGCAGTCCTGAAGCTGATGG - Intronic
995480161 5:112585321-112585343 CAGGGCAGTCCAGAGGCAGAGGG - Intergenic
995751390 5:115456680-115456702 CAGGGCAGGCTCTAAGAGGAAGG + Intergenic
998062836 5:139132711-139132733 CAGGCCAGGCCTTAAAAGGACGG - Intronic
999062580 5:148652486-148652508 CAGGGAGGTCCAGAAGAGCAGGG + Intronic
999682270 5:154071512-154071534 CAGGGCACTCCAGTATAGGAAGG - Intronic
1000052870 5:157577051-157577073 CGAGGCACTCCTGAAGATGATGG + Intergenic
1000063309 5:157674827-157674849 TAGTGCAGTCCTTAAGAGAAGGG - Intronic
1001042550 5:168347287-168347309 CAGGGCAGACCTCAAGAAGGAGG + Intronic
1001042899 5:168349501-168349523 CAGGGCTGTGCTGAAGGAGAGGG - Intronic
1001751947 5:174137929-174137951 CAGAACAGTCCTGAGGGGGAGGG + Intronic
1001978503 5:176021013-176021035 TAGGGCAGCCCTGATGAGGAGGG + Intronic
1002238914 5:177822749-177822771 TAGGGCAGCCCTGATGAGGAGGG - Intergenic
1002456209 5:179346381-179346403 CAGGGCCTTGCTGGAGAGGAGGG - Intergenic
1002600266 5:180350447-180350469 CAGGGCAGTGCTGCTGTGGAGGG - Intronic
1002800386 6:516508-516530 CAGGGCAGGCCTGAAGCCAAGGG + Intronic
1003372306 6:5540112-5540134 CACAGCAGTCCTGAAGAGGCCGG - Intronic
1006334630 6:33414176-33414198 CAGGGGAGTCCTGAGGTGGGAGG - Intronic
1006383872 6:33717983-33718005 CAGGGCAGTCTAGTAGTGGAAGG + Intergenic
1006471852 6:34234111-34234133 CAGGGAAGTCCTGGAGGAGACGG - Intergenic
1007493829 6:42245191-42245213 CAGGCCAGTCCTGGAGGGGAGGG + Intronic
1007686682 6:43671296-43671318 CACAGCTGTCATGAAGAGGATGG + Exonic
1007765929 6:44159617-44159639 CAGGGCACTTCTGAAGAACAAGG - Intronic
1007811067 6:44485947-44485969 CATCCCAGCCCTGAAGAGGAAGG + Intergenic
1007883735 6:45200711-45200733 CAGGGTAGGCCTAAAGAGAATGG - Intronic
1008731307 6:54485775-54485797 CAAGGCTGTGCTGAACAGGAAGG - Intergenic
1009291799 6:61891898-61891920 CAGGGCAGTCAGGAAGGAGAAGG + Intronic
1010035862 6:71324857-71324879 GAAGGGAGTCCTGAGGAGGAAGG + Intergenic
1012210379 6:96510899-96510921 CATGGCAGAGGTGAAGAGGAAGG - Intergenic
1013630269 6:111979769-111979791 AAGGGCTGTCTTGAAGAGGTTGG + Intergenic
1015144730 6:129972863-129972885 CATGGTAGCCCTGAAGAGGATGG + Intergenic
1016035310 6:139377356-139377378 CAGGGCAGTACTGTGGAGAATGG + Intergenic
1017582355 6:155880094-155880116 CAGGGCAGTGATGAAGAGCACGG + Intergenic
1018103610 6:160463292-160463314 CAGGGCAGTGATGAAGATTATGG - Intergenic
1018111904 6:160544538-160544560 CAGGGCAGTGATGAAGATCATGG - Intronic
1018131355 6:160734977-160734999 CAGGGCAGTGATGAAGATCATGG + Intronic
1018354727 6:163000884-163000906 CAAGGCAGGCCTGAATAGTAGGG + Intronic
1018574296 6:165243181-165243203 GACAGCAGTCCTGTAGAGGACGG - Intergenic
1018779334 6:167047457-167047479 CAGGGCAGCCCTGTAAGGGAAGG - Exonic
1019223914 6:170495472-170495494 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019223948 6:170495629-170495651 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224135 6:170496466-170496488 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224143 6:170496503-170496525 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019224169 6:170496620-170496642 CAGAGCGGTGGTGAAGAGGATGG + Intergenic
1019488826 7:1301635-1301657 CAGGGCTGTCCTGAGGACCAGGG - Intergenic
1020346342 7:7168225-7168247 GAGGCAAGTGCTGAAGAGGAGGG + Intronic
1022203329 7:28138990-28139012 CAAGGTAGACCTGAAGTGGAGGG + Intronic
1022480957 7:30742659-30742681 CTGGGCAGCCCTGCAGAGGCTGG - Intronic
1023220789 7:37918766-37918788 CCTGGAAGTCCCGAAGAGGAGGG - Intronic
1023853038 7:44160774-44160796 AAGGGCTGTCCCGAGGAGGATGG + Intronic
1025122457 7:56316875-56316897 CAGGTCAGTTCTTATGAGGAAGG + Intergenic
1026268968 7:68819949-68819971 AAGGGCTGTCCTGGAGATGACGG - Intergenic
1026447719 7:70500110-70500132 CAGAGCAGTGCTGGAGAGGGAGG - Intronic
1026955074 7:74371975-74371997 CAGGGCAGTTCTGAAGGGGCGGG - Intronic
1027238821 7:76314206-76314228 CTGGGCAGACCTGGAGAAGAGGG - Intergenic
1027346287 7:77263039-77263061 CATGACAGTCCTGAAGAGAACGG - Intronic
1027505358 7:79011224-79011246 GAGGGCATTCCTGAAAATGATGG - Intronic
1028449497 7:90965238-90965260 CAGGGCAGGACAGAAGAGGGTGG - Intronic
1028688478 7:93621212-93621234 CAGGGCAGACTGGAAGGGGAAGG + Intronic
1029288916 7:99486724-99486746 CAGGGCAGATATGATGAGGATGG + Exonic
1029622581 7:101699215-101699237 TGGGGCAGCTCTGAAGAGGAAGG - Intergenic
1032433127 7:131879214-131879236 CAGGGCAGCCATGAGGAGTAAGG + Intergenic
1032519530 7:132533508-132533530 CAGGGGAGTCCTGATGTGGATGG - Intronic
1033472347 7:141661412-141661434 CAGAGCACTTCAGAAGAGGATGG + Exonic
1034223734 7:149465767-149465789 CAGGGTAGTCATGAAGAAAAAGG + Intergenic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1034690877 7:153012830-153012852 CAGGGCAGAACAGAAGAGGTGGG - Intergenic
1034720713 7:153290058-153290080 GACCGCAGTCCTGAGGAGGAGGG + Intergenic
1035183578 7:157108522-157108544 CAGGGCAGTCCAGGAGCGGTAGG + Intergenic
1036991694 8:13605404-13605426 CAGGGCAGTGGTGAAAAGGACGG - Intergenic
1038698916 8:29831250-29831272 CTGGGCAGCCCTCAAGAGAAGGG + Intergenic
1038779003 8:30555261-30555283 CAGAGCATTCCTGAAGAAGAGGG + Intronic
1038931892 8:32202777-32202799 CAGAGCAGTGCAGCAGAGGAGGG - Intronic
1039440829 8:37594326-37594348 CGGGGCAGAGCTGAAGGGGAAGG - Intergenic
1041738049 8:61132314-61132336 CAGGGGAATCCTGGAGATGAGGG + Intronic
1044307020 8:90649683-90649705 GAGGGCAGTCCTTTAGATGAGGG - Intronic
1045254807 8:100510389-100510411 CAGGGCAGGACTGGAGAGGAGGG + Exonic
1046420737 8:113980250-113980272 ATGGGCAGCCCTGAAGAGGCGGG - Intergenic
1046653807 8:116871757-116871779 TAGGACAGTCATGAAGAGGTTGG - Intronic
1048034503 8:130664735-130664757 AAGGGCTGTCCAGAAGAAGAAGG - Intergenic
1049038423 8:140094630-140094652 GAGGGAAGTCCTCAAGAAGAGGG + Intronic
1049485684 8:142858800-142858822 CCGGGCATTCCTGGAGAGGAAGG + Intronic
1049702573 8:144021829-144021851 CAAGGCAGTCCTGAGGAGAGAGG - Intronic
1049929622 9:443923-443945 AAGAGCAGTGCTGAAGAGTAGGG - Intronic
1050386271 9:5094319-5094341 AAGGGGAGTCCAGAAGAGGAGGG - Intronic
1050521936 9:6509988-6510010 CAGGGCTGTCCTGAAGAATAGGG - Intergenic
1052070689 9:24078296-24078318 CAGGGCTTTGCTGAAGTGGAAGG - Intergenic
1055500735 9:76900150-76900172 CAAGGAAGTACAGAAGAGGACGG + Intronic
1055509764 9:76984601-76984623 CTGGGCAGTCTGGATGAGGAGGG - Intergenic
1056543311 9:87592853-87592875 CAGGGCAGGCAAGAAGAGGCTGG - Intronic
1057227901 9:93302130-93302152 CAGGGCAGCCCAAAAGAGAAGGG + Intronic
1057700263 9:97359093-97359115 CAGTGCAGTTGTGCAGAGGAAGG + Intronic
1057792995 9:98136178-98136200 CAAAGCAGTCCTGAAAAGGCAGG + Intronic
1059258966 9:112957570-112957592 CAGGGAATTACTGCAGAGGAAGG + Intergenic
1059559823 9:115323576-115323598 CAGGGGAGTCCTGAGAAGTAAGG + Intronic
1060073265 9:120569484-120569506 CTGGGCAGACTTGAAGAGAAAGG + Intronic
1061090083 9:128421320-128421342 CAGGGAAGGCCCCAAGAGGAAGG - Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1185836188 X:3347179-3347201 CCGGGGAGTCCTGGAGAGGCGGG - Intergenic
1185870910 X:3664080-3664102 CAAGGCAGTGTTGCAGAGGATGG - Intronic
1186577770 X:10784973-10784995 CAGGGCAGTCAGGCAGAAGAGGG + Intronic
1187076911 X:15944379-15944401 CAGGACAATTCTGCAGAGGAAGG + Intergenic
1189160339 X:38803961-38803983 CTGGGCAGGCCAGATGAGGAGGG - Exonic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191627518 X:63284290-63284312 AAGGGCAGCCCAGAAGAGGTGGG + Intergenic
1192697946 X:73437888-73437910 CAGGAAAGTGCTCAAGAGGAAGG - Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1192990794 X:76454150-76454172 CAGGCCAGTCTTGCAGAGGAAGG - Intergenic
1194605409 X:95973191-95973213 CAGGACAGTCCTGAGGGGGATGG + Intergenic
1199589827 X:149456970-149456992 CAGGGCTGGGCTGGAGAGGAAGG + Intergenic
1200149588 X:153944700-153944722 CAGCGGAACCCTGAAGAGGAGGG - Intergenic
1200793173 Y:7317429-7317451 CAAGGCAGTGTTGGAGAGGATGG + Intergenic
1200831850 Y:7693181-7693203 CAGGGCAGTGGGGATGAGGATGG - Intergenic