ID: 1072547653

View in Genome Browser
Species Human (GRCh38)
Location 10:96452342-96452364
Sequence AAGGAAAAAAGTCCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072547649_1072547653 24 Left 1072547649 10:96452295-96452317 CCATCTGGGGACAGTATTCTAGC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1072547653 10:96452342-96452364 AAGGAAAAAAGTCCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072547653 Original CRISPR AAGGAAAAAAGTCCTGAGGA GGG Intronic
No off target data available for this crispr