ID: 1072547944

View in Genome Browser
Species Human (GRCh38)
Location 10:96455019-96455041
Sequence GGCAAGCACCATATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072547944 Original CRISPR GGCAAGCACCATATGGGGAA AGG (reversed) Intronic
901106773 1:6762565-6762587 GGCAAGAACCATGTTGGGTAGGG + Intergenic
901895253 1:12306428-12306450 GGCAAGCACCATATGCCGAGTGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903751208 1:25622043-25622065 TGAAAACACCATATGGGCAAGGG - Intronic
904599034 1:31663856-31663878 GGCAAGCAGCATAGCGGGGAAGG + Intronic
905435343 1:37951758-37951780 GGTAAGCAGCATATGAGGGAGGG - Intergenic
909917683 1:81340371-81340393 GGCAAGCACAAGTTGGGCAAAGG - Intronic
910688995 1:89947122-89947144 GGAAAGCAGAATAAGGGGAATGG + Intergenic
912368909 1:109157657-109157679 GTCAAGCACCATGTGGGAAGGGG + Intronic
914460692 1:147880957-147880979 TTTCAGCACCATATGGGGAAAGG + Intergenic
915312209 1:155010428-155010450 GGGAAGCGTCATATGGGGGATGG + Intronic
918346450 1:183611485-183611507 GCCAAGCACTACATGGGAAAAGG + Intergenic
918644543 1:186888377-186888399 GGAAGGCACCAGATGGGAAAAGG - Intronic
920022609 1:202967134-202967156 GGCCAGAACCAGATGGGGAGGGG + Intronic
920039716 1:203087528-203087550 GGCAAGGACAATAAGAGGAAGGG + Intergenic
921564812 1:216704090-216704112 AGCAAGGTCTATATGGGGAACGG - Intronic
923647661 1:235840422-235840444 GGCAAAGACCAGATGGTGAAAGG + Intronic
1062880448 10:973977-973999 GTAAAGGACCACATGGGGAAAGG - Intergenic
1068047910 10:51910823-51910845 GACAAGCACCAGATGGGCAATGG + Intronic
1071877422 10:89856301-89856323 GGCAAGCACAATAAATGGAATGG + Intergenic
1072547944 10:96455019-96455041 GGCAAGCACCATATGGGGAAAGG - Intronic
1073206280 10:101770981-101771003 GGCAGCCACCCTATGGGGGAGGG + Intronic
1074475112 10:113766007-113766029 GGCAAAAACTATCTGGGGAAGGG - Intronic
1077929192 11:6712465-6712487 GACAGGCACCATGTGGGGCAGGG + Intergenic
1078237517 11:9499786-9499808 GGCAAACAACTTCTGGGGAAGGG - Intronic
1081522082 11:43891824-43891846 GGCAGACACCACATGGGCAAAGG - Intronic
1085053821 11:73392879-73392901 GGCAGGCACCATAAGGGGCTCGG + Intronic
1085238711 11:75034342-75034364 GGCAGGCCCAAGATGGGGAAGGG - Intergenic
1090464585 11:126922892-126922914 GGCAAGAACCATCTGGGAAGAGG - Intronic
1092233852 12:6793281-6793303 AACAGCCACCATATGGGGAAGGG + Intronic
1092329527 12:7570515-7570537 GGCAAGCAACACCTGAGGAAAGG + Intergenic
1092356077 12:7796586-7796608 GGCAGGCACAAGATGGGAAAAGG - Exonic
1092691099 12:11110648-11110670 AGCAAGCACTAAATGTGGAAAGG + Intronic
1093978573 12:25450866-25450888 GCCAACCAGCATATGGGAAAAGG + Intronic
1096849983 12:54429173-54429195 GGGAAGCTCCTTATTGGGAAAGG - Intergenic
1097521413 12:60675260-60675282 GGAAAGCATCATTTGGGGCATGG - Intergenic
1103330070 12:120148139-120148161 GGCAAGCACCCTCACGGGAAAGG + Intronic
1104146922 12:126043361-126043383 GTCCAGCATCAGATGGGGAAAGG + Intergenic
1107130240 13:36886981-36887003 GGAAAGCAGCATATGGAAAATGG + Intronic
1119321864 14:73736925-73736947 GCCCAGGACCCTATGGGGAAAGG - Intronic
1121941687 14:98076678-98076700 GGCAAGCACCTTAAGGGGTCTGG - Intergenic
1128613024 15:69088918-69088940 GGCAGGCAACATAAGGAGAAGGG - Intergenic
1128720204 15:69942322-69942344 AGCAACCACCATATGGGTGATGG - Intergenic
1129123046 15:73414600-73414622 GGCAAGAACCATATGGGCACAGG + Intergenic
1132569594 16:638320-638342 GGGAAGCCCCATGTGGGGAAGGG - Intronic
1137841267 16:51643001-51643023 TGCCAGCACCATATGTTGAAAGG - Intergenic
1140986240 16:80160533-80160555 GGCACTCACAATATGGGGAAAGG + Intergenic
1148128097 17:45247140-45247162 TGCAAGCAGCATTTGGGGGAAGG - Exonic
1150133419 17:62681141-62681163 GGCAGGCAGCAGATGTGGAAGGG + Intronic
1153163522 18:2236686-2236708 GGGCTGCACCAGATGGGGAAGGG + Intergenic
1162963363 19:14142275-14142297 GGCACTCATCATTTGGGGAACGG - Intergenic
1163302515 19:16456944-16456966 GGCAAGCAGAACATGGGGAGGGG + Intronic
1164663708 19:30006134-30006156 TGCAGGCACCATAAGAGGAATGG - Intronic
1165254383 19:34566359-34566381 AGGAAGCACTAAATGGGGAAAGG - Intergenic
1165698474 19:37919223-37919245 GGTGAGCACCATCTGGGGACAGG - Intronic
1165723814 19:38098771-38098793 GGGAAGCAACATCTGGGGAATGG + Intronic
1167402618 19:49283001-49283023 GGCCTGCACCATATGTAGAATGG - Intergenic
926381229 2:12292074-12292096 GGGAAGCCCCATATGGAGAGGGG - Intergenic
926760124 2:16271083-16271105 AGCAAGAAGCAAATGGGGAAGGG + Intergenic
927703213 2:25280990-25281012 GGGAAGCACCACATTTGGAAGGG + Intronic
927789963 2:26002130-26002152 GGCAAGCACCCAGTGGAGAAGGG - Intergenic
929423215 2:41816237-41816259 GGTGAGAACCAGATGGGGAAGGG + Intergenic
929428409 2:41867378-41867400 GGCAAGCCCCATCTGGGGAAAGG + Intergenic
931138055 2:59426742-59426764 AGAAAGCAACATTTGGGGAAGGG + Intergenic
933702020 2:85262480-85262502 GCCAAGCAGAATATGGAGAAAGG + Intronic
941016656 2:160365043-160365065 GACAAGAACCTTATGAGGAAGGG - Intronic
942063732 2:172251104-172251126 GGCAAGCACCAGAGAGAGAAAGG + Intergenic
942638036 2:178029920-178029942 GGAAGGCATCATATGGTGAAAGG - Intronic
942739032 2:179152310-179152332 GGCAAGCACCACAGAGAGAAAGG + Intronic
945518627 2:210795642-210795664 TGCAAGCACCATATTGGTGAAGG + Intergenic
948230933 2:236348949-236348971 GGCAGGCACCATGTGGGGATGGG - Intronic
1169923250 20:10757237-10757259 GGTAAGCAACACATGGAGAATGG + Intergenic
1169926326 20:10788189-10788211 GGCAGCCACCAGATGGGGAGAGG - Intergenic
1178137610 21:29645488-29645510 GGCGGGCTCCATATTGGGAAAGG + Intronic
1178389835 21:32189193-32189215 GGCAAGGACCACATCGTGAAGGG - Intergenic
1180998173 22:19975785-19975807 GGCAGACCCCATATGGGGAATGG + Intronic
1181473114 22:23152860-23152882 AGCAAGGACAATGTGGGGAAAGG - Intronic
1182077274 22:27503626-27503648 GGAAAGCACTATATGGGCAAAGG + Intergenic
1184029728 22:41885096-41885118 GGGCAGCACCTGATGGGGAAGGG - Intronic
1184867418 22:47209410-47209432 GGCAACCGCCCTGTGGGGAAGGG - Intergenic
957992094 3:87639178-87639200 GGGAACCACTAGATGGGGAAAGG - Intergenic
960416720 3:117393914-117393936 AGCAAGCAGCAAATGGAGAAGGG - Intergenic
965692899 3:171376582-171376604 GACAAGCAGCATATGAGAAAAGG + Intronic
965707558 3:171524368-171524390 AGCAAGCAGCAGAAGGGGAAAGG + Intergenic
969401316 4:6957518-6957540 GGCGAGCGCTATATGGGTAAAGG - Intronic
971130516 4:23804205-23804227 GGAAAGAACCAAATGGGGAGAGG - Intronic
971639031 4:29104880-29104902 GGAAATCTCCATATGGGGATAGG + Intergenic
975730174 4:77330030-77330052 TGCCAGGAACATATGGGGAAAGG + Intronic
986566854 5:9124134-9124156 GGCAGGGACCTTATGGGGAGGGG + Intronic
991657105 5:68914903-68914925 GGGATGGACCATGTGGGGAAGGG - Intergenic
993360202 5:86965491-86965513 AGTAAGCACATTATGGGGAATGG - Intergenic
1002947510 6:1777126-1777148 GCCAGGCACCATATGGGCATGGG + Intronic
1003704400 6:8508257-8508279 CACAACCACCATATGAGGAAAGG - Intergenic
1004193081 6:13481313-13481335 GGCAAGAACCTTCTGGGCAAAGG + Intronic
1006423465 6:33949674-33949696 GGCAAGGGCCAGATGGTGAAGGG - Intergenic
1006824979 6:36928262-36928284 GGCAAGCACTGTGTGGAGAAAGG + Intronic
1007521989 6:42457421-42457443 GGAAAGTTCCATATGGGAAATGG - Intergenic
1013872746 6:114786783-114786805 GCCAAGCACCAAATGGAGAAAGG - Intergenic
1019427425 7:984194-984216 GCCAAGCACCAGATGGCGAGAGG + Intronic
1021224363 7:18011081-18011103 GGGAAGCACTAAATGTGGAAAGG - Intergenic
1024518788 7:50284591-50284613 GGCCAGCAGCATAGTGGGAATGG - Intergenic
1029494169 7:100888303-100888325 GACCAGCACCATACGGGGCATGG - Exonic
1030089340 7:105843604-105843626 GGCAAGCACCTTTTGGAAAACGG + Intronic
1030165604 7:106552160-106552182 GGCAGACACCAAATGAGGAATGG - Intergenic
1037742976 8:21622125-21622147 GAAAAGCACCAGATGGGGAGAGG + Intergenic
1038201083 8:25413335-25413357 GGAAACCACCATTTGGAGAAGGG - Exonic
1044242591 8:89903342-89903364 TACAATCACCTTATGGGGAAAGG + Intronic
1045157588 8:99493838-99493860 GGTAAGGACCATATGGACAAAGG + Intronic
1048978002 8:139683790-139683812 GGCAGGCATGATATGGGAAATGG + Intronic
1049442451 8:142615529-142615551 GCCAAGCACCATATAAGGAGCGG + Intergenic
1051616571 9:19012509-19012531 GGCACGAACCATATGGGGGACGG + Intronic
1056099134 9:83284227-83284249 AGCAGGAACCATAAGGGGAAAGG + Intronic
1190931804 X:54954993-54955015 GGCTAACAGCATATGGTGAAAGG - Intronic
1194579513 X:95654760-95654782 GGCAATTACCATTTGGAGAAAGG + Intergenic
1195698002 X:107680994-107681016 GGTAAGCAGAATTTGGGGAATGG + Intergenic
1201962484 Y:19697112-19697134 GCCAATCAACATATGGGCAAAGG + Intergenic