ID: 1072547985

View in Genome Browser
Species Human (GRCh38)
Location 10:96455337-96455359
Sequence GCTGATTGGCCAAGATACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072547982_1072547985 -8 Left 1072547982 10:96455322-96455344 CCCTGGGACAGTGGAGCTGATTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 1072547985 10:96455337-96455359 GCTGATTGGCCAAGATACACTGG No data
1072547981_1072547985 0 Left 1072547981 10:96455314-96455336 CCTGTTATCCCTGGGACAGTGGA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1072547985 10:96455337-96455359 GCTGATTGGCCAAGATACACTGG No data
1072547983_1072547985 -9 Left 1072547983 10:96455323-96455345 CCTGGGACAGTGGAGCTGATTGG 0: 1
1: 0
2: 0
3: 27
4: 212
Right 1072547985 10:96455337-96455359 GCTGATTGGCCAAGATACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072547985 Original CRISPR GCTGATTGGCCAAGATACAC TGG Intronic
No off target data available for this crispr