ID: 1072548847

View in Genome Browser
Species Human (GRCh38)
Location 10:96461600-96461622
Sequence GAGGCTAAACAAAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072548847 Original CRISPR GAGGCTAAACAAAGGCATGG AGG (reversed) Intronic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
904180561 1:28663816-28663838 GAGCCTTAACAAAGGAATGAAGG + Intergenic
904383669 1:30127893-30127915 GAGCCTACCGAAAGGCATGGAGG + Intergenic
906619586 1:47264946-47264968 AAGCCAAAACAAGGGCATGGTGG + Intronic
906725066 1:48038430-48038452 GAGTCTGAACAAAGACCTGGAGG + Intergenic
906815034 1:48870003-48870025 TAGCATAAGCAAAGGCATGGAGG - Intronic
907558895 1:55370154-55370176 GAGTCTAGACAAAGGTTTGGAGG + Intergenic
908406227 1:63816625-63816647 GAGGCTAAAGAAACCCATGCTGG - Intronic
909484404 1:76157315-76157337 GAGGCTACAGATAGGCAAGGGGG - Intronic
911543019 1:99182039-99182061 GAGGTTGACCAAAGGCATGCTGG - Intergenic
911951260 1:104176703-104176725 GAGGCAAAACAAAGACAGGTAGG - Intergenic
913182647 1:116337005-116337027 GAGGGAAAAGAAAGGAATGGGGG - Intergenic
914872118 1:151483898-151483920 AATGGTAAACTAAGGCATGGTGG - Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
919518568 1:198557708-198557730 GACTCTAAAGAAAGACATGGAGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
919847235 1:201649676-201649698 GAGGCTGGACAATGGGATGGGGG + Intronic
924662256 1:246031907-246031929 GATTTTAAACAAAGGCAGGGTGG - Intronic
1063334299 10:5196738-5196760 GGGGCTAATCAATGGCATGTAGG - Intronic
1064596691 10:16952891-16952913 GAGGCTAAACTAGGACTTGGAGG + Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1066010725 10:31191577-31191599 GAGGATAAGCAAAGGCCCGGAGG + Intergenic
1070824374 10:79382164-79382186 GAGGCAAATCAATGGCATGGAGG + Intergenic
1070916417 10:80157966-80157988 GAGGCTCAACAAGGCCATGAGGG - Exonic
1071495435 10:86164652-86164674 GAGTTTAAGCCAAGGCATGGAGG + Intronic
1071804210 10:89099060-89099082 GAGCACAAACAAAGGCCTGGAGG + Intergenic
1072114195 10:92353581-92353603 GAGGTAAAAGAAAGGCATTGGGG + Exonic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1073463607 10:103680942-103680964 GCGGAAAAACAAAGACATGGGGG - Intronic
1073961249 10:108931624-108931646 GAGCTTAAGCAAAGCCATGGCGG - Intergenic
1074303408 10:112253176-112253198 GACTCAAAACAAAGGGATGGAGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1075256956 10:120932943-120932965 GAGGCTAAGAAGAGGCAAGGAGG + Intergenic
1076405747 10:130211677-130211699 TAGGCGAAAGAAAGCCATGGCGG + Intergenic
1076684002 10:132188502-132188524 GAGGCTCTGCAAATGCATGGTGG + Intronic
1078194267 11:9121846-9121868 GTGGGGAAACCAAGGCATGGGGG - Intronic
1078481824 11:11683378-11683400 AAGGAGAAGCAAAGGCATGGTGG - Intergenic
1078614426 11:12852113-12852135 GTGGTTCCACAAAGGCATGGAGG + Intronic
1079054930 11:17197318-17197340 GAGGCTAAAGAATGGAGTGGGGG - Intronic
1079080549 11:17410681-17410703 GAGGGTAGGGAAAGGCATGGTGG + Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1084520316 11:69658633-69658655 GTGATTAAACAAAGGCAAGGAGG - Intronic
1086252137 11:84828653-84828675 GAGGAAAAATAAAGACATGGAGG + Intronic
1086573300 11:88308874-88308896 GAGGCTAATCCATAGCATGGGGG + Intronic
1087508892 11:99064580-99064602 GATGGTAAATAAAGGGATGGAGG - Intronic
1087776275 11:102259829-102259851 GAGGTTAGGCAAAGGCATGGTGG - Intergenic
1088724134 11:112619608-112619630 GAGGCCCAGCAAAGGCAGGGTGG + Intergenic
1088810817 11:113390752-113390774 AAAGCAAAAAAAAGGCATGGAGG + Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1089076075 11:115739892-115739914 CAGGCCCTACAAAGGCATGGTGG - Intergenic
1090254720 11:125275415-125275437 GAGGCCACACAAAGGCATTTGGG + Intronic
1090586793 11:128221859-128221881 TGGGGTAAACAAAGACATGGAGG - Intergenic
1091099730 11:132860286-132860308 GATGCAGAACAAAGGCCTGGAGG + Intronic
1091403109 12:192829-192851 GAGGCGATACAAAGGAAGGGAGG + Intronic
1091403119 12:192891-192913 GAGGCGATACAAAGGAAGGGAGG + Intronic
1093757114 12:22865049-22865071 GAGACAAAAGAAAGGCATGGAGG - Intergenic
1094069496 12:26397307-26397329 CAGGATAAGCAAAGTCATGGAGG - Intronic
1095406528 12:41872428-41872450 TAGGCTCAATAAAGGAATGGAGG + Intergenic
1095989022 12:48021405-48021427 GAGCCTAAAAAAAGGCACTGTGG - Intronic
1096581064 12:52585670-52585692 AAGGCCCAAGAAAGGCATGGGGG + Exonic
1099398936 12:82178605-82178627 GAGCCTAAACAAAGGTATTGAGG + Intergenic
1099780650 12:87191327-87191349 AAAGCTAAACAAAGGAATTGTGG - Intergenic
1099874694 12:88390453-88390475 GAGGCTTATGAAAGGAATGGGGG - Intergenic
1100359389 12:93862085-93862107 GAGGCCTCACAAAGGCATGGTGG - Intronic
1100426960 12:94496543-94496565 TAGGCTAAACAAAGGAAAAGGGG - Intergenic
1100717832 12:97324560-97324582 GAGGAGAGAGAAAGGCATGGTGG + Intergenic
1101573652 12:105978368-105978390 GAGGCTGAACACAGGCTGGGAGG - Intergenic
1102240824 12:111323502-111323524 GAGGCTGAGGACAGGCATGGGGG + Intronic
1102252148 12:111394706-111394728 GAGGCTGCAGAAAGGCATGGGGG - Intergenic
1103391451 12:120576720-120576742 GCAGCCAAACAAAAGCATGGGGG - Exonic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104987498 12:132605055-132605077 GAGGGTAAACCAAGGCACTGAGG + Intronic
1108638251 13:52357674-52357696 GAGGCTAAGAACAGGAATGGAGG + Intergenic
1108850086 13:54717899-54717921 GAGACAAAATAAAGGGATGGAGG - Intergenic
1109690009 13:65874400-65874422 GATGCAAAACAAAGTAATGGAGG + Intergenic
1110821603 13:79924092-79924114 GACTCAAAACAAAGGGATGGAGG - Intergenic
1111820976 13:93214774-93214796 GAGGTCATACAGAGGCATGGTGG + Intergenic
1112199434 13:97260752-97260774 GTGGTTAAACAGAGGCCTGGTGG + Intronic
1115828094 14:37300160-37300182 GAGTATGAACAAAGGAATGGAGG - Intronic
1115902573 14:38169347-38169369 TAGGATAAACAAAGTCATGGAGG + Intergenic
1117221247 14:53608693-53608715 GAGGCTTGACAAAGGCTTAGAGG - Intergenic
1117328951 14:54693954-54693976 GAGGCTAAACATGGGTGTGGGGG + Intronic
1119190109 14:72675617-72675639 GAGGCAAAGCAGAGGCATGGAGG - Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120020113 14:79520229-79520251 GAGGTTCAACCAAGGCATGCCGG - Intronic
1121017866 14:90559274-90559296 GGGGCTAAACAATGACTTGGAGG + Intronic
1121331065 14:93050071-93050093 GGGGCAAAACAAAGGCCAGGGGG + Intronic
1121676136 14:95754540-95754562 TAAGATAAACAAAGGCATGGAGG - Intergenic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123473083 15:20569115-20569137 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1123644923 15:22431238-22431260 GTGGGGAAACAAAGGCCTGGAGG + Intergenic
1123733382 15:23164126-23164148 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1123751511 15:23361497-23361519 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1124283884 15:28385422-28385444 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1124298814 15:28526192-28526214 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1124959277 15:34382734-34382756 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1124975903 15:34528955-34528977 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1128085306 15:64882384-64882406 GTGGCTAAACGAAGGGAGGGAGG - Intronic
1128297509 15:66536881-66536903 GAGGCCAAAGAAAGGCTTCGTGG - Intronic
1128376905 15:67083269-67083291 GTGGTTAAACAAAGGGTTGGGGG - Intronic
1129029826 15:72610062-72610084 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1129038034 15:72662801-72662823 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1129190796 15:73936533-73936555 GAGGATAAACAAAGTCCAGGAGG - Intronic
1129211855 15:74074430-74074452 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1129398548 15:75266654-75266676 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1129402156 15:75290930-75290952 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1129728975 15:77918702-77918724 GTGGGGAAACAAAGGCCTGGAGG + Intergenic
1129839527 15:78735164-78735186 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1130027484 15:80282292-80282314 GAGGCTACAGTAAGCCATGGTGG + Intergenic
1130734977 15:86538566-86538588 GAGGCTAACTAAAGCCCTGGAGG - Intronic
1131188019 15:90292175-90292197 GTGGGGAAACAAAGGCCTGGCGG - Intronic
1131270571 15:90945185-90945207 GAGGCTGAACAAAGGGAAAGTGG + Intronic
1131303650 15:91222029-91222051 AAGGCTATGCAGAGGCATGGAGG - Intronic
1132432927 15:101775218-101775240 GTGGGGAAACAAAGGCCTGGAGG + Intergenic
1135562992 16:23490923-23490945 GAGGTTAAAGATGGGCATGGTGG + Intronic
1137920444 16:52482655-52482677 GAAGCTAAAAAAAGGGAGGGGGG + Intronic
1139234378 16:65319065-65319087 GAGCCTGAATAAAGGCCTGGAGG + Intergenic
1139973362 16:70790294-70790316 GAGGCTGAACAAAGGCTCAGAGG + Intronic
1140721144 16:77773387-77773409 GAGGCAAAAGAAAAGCTTGGTGG - Intergenic
1141018435 16:80471986-80472008 GAGGCAAAACTAACCCATGGTGG - Intergenic
1141398437 16:83725231-83725253 TGGGATAAACAAAGGCATGGTGG + Intronic
1141847098 16:86618300-86618322 TAGCTTGAACAAAGGCATGGAGG - Intergenic
1143311007 17:5989186-5989208 AAGATTAAACAAAGGCTTGGAGG + Intronic
1145221118 17:21089485-21089507 GAGGCTAAATAAATCCATGTTGG + Intergenic
1146479821 17:33196198-33196220 GAGGTTAAACAATTGAATGGAGG + Intronic
1146506767 17:33412677-33412699 GTGGATAAACATAGGCATAGAGG + Intronic
1146616552 17:34361493-34361515 GAGGTTTAACAAAAGCATGAGGG - Intronic
1146768114 17:35542498-35542520 GAGGCTACAGAAAGCCATGATGG - Intergenic
1147034533 17:37670504-37670526 GAGGCTTCAGGAAGGCATGGAGG - Intergenic
1147415171 17:40283685-40283707 GAGGCTAAAGAAAAGAAGGGTGG + Exonic
1148644028 17:49209108-49209130 GAGGCTAACGCAAGGCAAGGTGG - Intronic
1149001030 17:51757808-51757830 GAGGCTAGATAAGAGCATGGTGG + Intronic
1149982981 17:61325992-61326014 GATGCCAAACAAATGAATGGTGG - Intronic
1151907007 17:77055173-77055195 GAGGCTGGGCAAAGGCAGGGAGG - Intergenic
1153574104 18:6503913-6503935 GAGGATAAAGAAAGGAAAGGAGG + Intergenic
1155115365 18:22760670-22760692 GGGGCAAAAGAAAGGGATGGAGG + Intergenic
1155456483 18:26020849-26020871 TAGCTGAAACAAAGGCATGGAGG + Intronic
1155943124 18:31819628-31819650 TAGGCTAAACAAAAGAAAGGGGG - Intergenic
1159349292 18:67250901-67250923 GAGGATGAATAAAGGAATGGAGG + Intergenic
1160364150 18:78309666-78309688 GACGCGAGACAAAGGCAGGGTGG + Intergenic
1160415017 18:78703692-78703714 GAGGCAGGACAGAGGCATGGCGG + Intergenic
1160485023 18:79283007-79283029 GAGGCCTCACAAAGGCAAGGGGG - Intronic
1162441165 19:10692996-10693018 GATGCAAAACAAAGGAATGCTGG + Intergenic
1165566980 19:36738865-36738887 GAGGCTGAGAAAAGTCATGGGGG + Intronic
1166511232 19:43410295-43410317 TGGGGTAAACAAATGCATGGGGG + Intronic
1168502823 19:56907979-56908001 GAGGCAATACTAGGGCATGGGGG - Intergenic
926226651 2:10971668-10971690 GAGGAGAAACAAGGGCACGGAGG + Intergenic
929224466 2:39498929-39498951 GTTGCTAATCAATGGCATGGGGG - Intergenic
929821118 2:45274503-45274525 GAGGCTGAAGAATGGCAGGGAGG + Intergenic
934018525 2:87917574-87917596 GAGGCTATAGCAAGACATGGTGG + Intergenic
936241626 2:110792829-110792851 AAGGCCAAGCAAAGGCTTGGTGG + Intronic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
940829445 2:158452221-158452243 GAGGCTACACAAAGGAAAGGGGG + Intronic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
946663674 2:222027877-222027899 GAGGCTAAGCAATGTCATGCAGG + Intergenic
948445699 2:238031170-238031192 GAGGCTAAGAAAAGGCTGGGTGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1168834814 20:871085-871107 GAGGCTAAATAAAGGTCTGCTGG + Exonic
1169304776 20:4479811-4479833 GCTTCTAAACAAAGGGATGGTGG + Intergenic
1172612664 20:36263170-36263192 GATGCTACACACAGGTATGGTGG + Intronic
1173720550 20:45253990-45254012 AAGGCTACACAAAGGCAGAGAGG + Intronic
1174591410 20:51648161-51648183 CAGGCTATACCCAGGCATGGAGG + Intronic
1174713618 20:52733241-52733263 CATGCTAATCAAAGGCAAGGTGG + Intergenic
1174843764 20:53923368-53923390 AAGGCTAAACATTTGCATGGGGG + Intergenic
1175877643 20:62238107-62238129 GAGGCTACCCAAAGCCCTGGGGG - Intronic
1177045085 21:16159417-16159439 GAGGCTAAACAATATTATGGTGG - Intergenic
1177261045 21:18730374-18730396 TACGCTTAACATAGGCATGGTGG + Intergenic
1181646310 22:24233264-24233286 CAGGCTGGACAAAGGCCTGGAGG - Intronic
950149697 3:10677245-10677267 GAAGCCATACAAAGACATGGAGG + Intronic
950171222 3:10840234-10840256 GAGGCCAAAGAAGGGCATGGTGG - Intronic
950199576 3:11033773-11033795 GAGGCTAGACCAAGCCCTGGGGG + Intronic
950485588 3:13272196-13272218 GAGGCAAAACAAAGCAAGGGTGG - Intergenic
951996646 3:28736863-28736885 GAGGATGAAGAAAAGCATGGTGG - Intergenic
955290142 3:57684470-57684492 GAGTCTAAAGCCAGGCATGGTGG + Intronic
956326119 3:68054990-68055012 GACCCTAAACCAAGGCATAGAGG - Intronic
956840416 3:73134792-73134814 GAGGCTAAAAAAAGGATTTGAGG - Intergenic
957129091 3:76200206-76200228 TAGGCTAAACAAAGGAAAAGGGG + Intronic
957927371 3:86832014-86832036 GATACTAAACAAAGGGAAGGGGG + Intergenic
958867470 3:99517811-99517833 AAGACTAAGCCAAGGCATGGTGG - Intergenic
959571843 3:107893210-107893232 CTGGCTAAGCCAAGGCATGGAGG + Intergenic
960078620 3:113516089-113516111 GGGGCTAAAAACAGGCAAGGTGG + Intergenic
962565022 3:136649114-136649136 TAGTATAAGCAAAGGCATGGAGG - Intronic
963299312 3:143581209-143581231 GAGTGTAAAGAAAGGCAAGGAGG + Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
964931090 3:162024227-162024249 GCGGCTAAACAAAGGTAAAGGGG - Intergenic
966013580 3:175112957-175112979 AAGGTTGAACAAAGACATGGAGG + Intronic
966319793 3:178689319-178689341 GATGCTATACAAATGCAAGGCGG - Intronic
966413980 3:179670386-179670408 GAGGCAAAAGAAGGCCATGGGGG - Intronic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967817783 3:193813842-193813864 GAGAATAAAGAAAGGCATGAGGG + Intergenic
968023880 3:195421257-195421279 GAGTCCAAACAAAGGCATTTTGG + Intronic
968656447 4:1780319-1780341 GAGCCTCCACAAAGGCCTGGAGG - Intergenic
969839159 4:9868030-9868052 GAGGCTAAAGACACGCCTGGTGG - Intronic
970465024 4:16313875-16313897 GAGCCTGAACAAAGACATAGAGG + Intergenic
971607239 4:28673409-28673431 GAGGCTTAATAAAGCTATGGTGG + Intergenic
971968844 4:33595655-33595677 GTGGCAAGACACAGGCATGGTGG - Intergenic
973191933 4:47395240-47395262 CAGGCTATACAAAGGCTTGGAGG + Intronic
973739996 4:53910440-53910462 GAAGCTGAACAAAGGCAAAGAGG + Intronic
973798101 4:54449362-54449384 GAAACTAAACAAAGCCATGTAGG - Intergenic
975591022 4:75999943-75999965 GAGGCTCAACAAAGGAGGGGAGG + Intergenic
975809540 4:78152387-78152409 GGCCCTAAACAAAGGCATGCTGG - Intronic
976181353 4:82402148-82402170 GAGGCTAGAATAAGCCATGGAGG + Intergenic
976370727 4:84285779-84285801 GAGGCTGAGCCAAGGCAGGGTGG + Intergenic
978322359 4:107511924-107511946 AAGGCTATACAAAGGTATAGAGG - Intergenic
978636269 4:110810906-110810928 GAGCCTGAACACAGACATGGTGG - Intergenic
979456153 4:120927961-120927983 GTGGCTAACCAAGGCCATGGTGG + Intergenic
980498749 4:133620143-133620165 GAGGATAAACAAACACATGTGGG - Intergenic
980888112 4:138785402-138785424 GAGTGTAAACAAAGTCCTGGGGG - Intergenic
981048703 4:140290433-140290455 GAGTGGAACCAAAGGCATGGGGG - Intronic
982149249 4:152434481-152434503 GGGGGTAAACTAAGGCATAGAGG - Intronic
984171065 4:176359845-176359867 GAGTCTGCAGAAAGGCATGGGGG - Intergenic
984877935 4:184386022-184386044 GAAGGAAAACAAAGGCATTGGGG - Intergenic
986295221 5:6432000-6432022 GAGGTTAAACAAGGTCATTGGGG - Intergenic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
990943616 5:61228520-61228542 GTGGCAAAACAAAAGCACGGTGG + Intergenic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
995423834 5:111996969-111996991 GAGGCTAAACAAAGGAACAAAGG + Intronic
995921783 5:117323092-117323114 GAGCCTGGACAAAGGCATGAAGG + Intergenic
997465998 5:134088456-134088478 GGGGCTGACCACAGGCATGGAGG + Intergenic
997634103 5:135391825-135391847 GAGGCTGAACCAACGCAGGGAGG - Intronic
1003247021 6:4391079-4391101 GAGGCTAACCACAGGCGTGGTGG - Intergenic
1003778912 6:9400569-9400591 TGGCATAAACAAAGGCATGGAGG - Intergenic
1004190535 6:13459844-13459866 GAGGCTCATTACAGGCATGGTGG + Intronic
1005178814 6:23079894-23079916 GAGGCTGATCAAGGGCATCGTGG - Intergenic
1005325049 6:24691987-24692009 GAGACTAAACATGGGGATGGTGG + Intronic
1005472436 6:26174488-26174510 GAAGCTATACACAGGCATGATGG - Intergenic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1007506286 6:42337726-42337748 TAGCATAAGCAAAGGCATGGAGG + Intronic
1009925168 6:70112169-70112191 GAGGTCAAACAAGGGGATGGAGG + Intronic
1010205312 6:73317323-73317345 CAAGCCAAAGAAAGGCATGGAGG + Intergenic
1010972900 6:82282249-82282271 GACTCAAAACAAAGGGATGGAGG - Intergenic
1012831584 6:104210209-104210231 GAGCCTAAACAAAGGACTGCGGG + Intergenic
1015251613 6:131133843-131133865 GAGGCTAGACAAAGGAAAAGGGG + Intergenic
1015965631 6:138693231-138693253 GAGGCGAAAGAAAGGAAAGGGGG + Intergenic
1016273683 6:142322485-142322507 GAGGCTAAAGAAAGGTGAGGTGG - Intronic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1019635547 7:2073704-2073726 GAGGGTAGACAGAGGCATAGGGG + Intronic
1022058598 7:26768321-26768343 GAGTCAAAATAAAGGGATGGAGG - Intronic
1022191381 7:28019627-28019649 GAAGCTAAATAAAGTCAAGGAGG - Intronic
1022191623 7:28021606-28021628 TAGGACAAACAAAGACATGGTGG + Intronic
1022264418 7:28740051-28740073 GTGGCTGAAAAAAGGAATGGGGG + Intronic
1023079412 7:36513498-36513520 GAGGTTATACAGAGACATGGGGG - Intronic
1023105098 7:36756092-36756114 GGGGGTAAACAAAGGCAAAGAGG + Intergenic
1023455795 7:40337610-40337632 GACTCAAAACAAAGGGATGGAGG - Intronic
1024505430 7:50158256-50158278 GAGGCTAGGAAAAGACATGGGGG - Intronic
1028413744 7:90558317-90558339 GAGGCAAGTCAAGGGCATGGTGG + Intronic
1029514170 7:101015729-101015751 GAGGGTGAAGAAAGGCAGGGCGG + Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1030380340 7:108803832-108803854 GGGTCTAAACAAAGGCAGTGAGG - Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1036590700 8:10165486-10165508 GAGACTAAAGACAGGCAAGGGGG + Intronic
1037668490 8:20994352-20994374 GTGTCTATACAAAGGCATGATGG + Intergenic
1037892134 8:22628999-22629021 GAGGCTCAGCGAAGGCAGGGAGG - Intronic
1037898874 8:22676010-22676032 GAGGCCAAACAAGGGCAGGAAGG + Intergenic
1038033310 8:23663497-23663519 GGGCCTAAGCAAAGGCAGGGAGG - Intergenic
1040012800 8:42676359-42676381 CAGGCAAGACAAAGGCATGGAGG - Intergenic
1040884744 8:52249363-52249385 GAGGCAGAACAAAGGCTAGGAGG - Intronic
1041051049 8:53934387-53934409 GACTCAAAATAAAGGCATGGAGG + Intronic
1041627442 8:60046416-60046438 GAAGCTTAACATAGGTATGGAGG + Intergenic
1042221483 8:66478632-66478654 GAGCCTGAACAAAGCTATGGAGG - Intronic
1043006684 8:74828300-74828322 GAGTCTAGACAAAGGTCTGGAGG + Intronic
1043032703 8:75157398-75157420 GAACCTAAACAAAAGCATGGTGG - Intergenic
1044223018 8:89691647-89691669 TAGGCTTAAAAAAGTCATGGAGG - Intergenic
1044350745 8:91163271-91163293 GAGGCTAAAAAAATGGAGGGTGG - Intronic
1045496616 8:102714775-102714797 GAGGAGAAAGAAAGCCATGGAGG - Intergenic
1045726494 8:105179465-105179487 GTGGGTAAAGAAATGCATGGAGG - Intronic
1045901068 8:107280601-107280623 TAGCATAAACAAAGGCATGGAGG + Intronic
1047336427 8:123940890-123940912 GAGGGGAAGGAAAGGCATGGAGG + Intronic
1051568736 9:18530595-18530617 GAAACTAAGCAAAGGCATAGAGG - Intronic
1052434077 9:28403544-28403566 GAGGTTAAATAAAGGTATTGCGG - Intronic
1056628311 9:88272607-88272629 GAGGCTAAAAGATGTCATGGCGG - Intergenic
1059341159 9:113598344-113598366 GAGGGGAAACAAAGGCACAGTGG - Intergenic
1059788850 9:117617887-117617909 ATGTCCAAACAAAGGCATGGAGG - Intergenic
1186222471 X:7364577-7364599 CAGGCTACAAGAAGGCATGGAGG + Intergenic
1186964601 X:14773594-14773616 ACATCTAAACAAAGGCATGGAGG + Intergenic
1187785085 X:22875529-22875551 GAAGCCACAAAAAGGCATGGAGG + Intergenic
1188023040 X:25179131-25179153 GAGGCTCAACTAAGGCATTCAGG + Intergenic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1189967176 X:46386930-46386952 TAGGCTAAACAAAGGAAAAGGGG - Intergenic
1190280083 X:48923624-48923646 GAGGCTTACCAAAGGCAGAGGGG + Exonic
1192226098 X:69229054-69229076 GAGCATAGACAAAGGCATGGAGG + Intergenic
1192303075 X:69927014-69927036 GACTCAAAACAAAGGGATGGAGG - Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1193229770 X:79030460-79030482 GACTCAAAACAAAGGGATGGAGG - Intergenic
1193441232 X:81541091-81541113 GCAGTTAAACAAAGGCTTGGGGG + Intergenic
1197294862 X:124706509-124706531 GAGGCAAAACAAATGTATGGTGG - Intronic
1197758969 X:130014697-130014719 GGGGGTCAACACAGGCATGGGGG - Exonic
1199126006 X:144121564-144121586 GAGGCTATAGCAAGACATGGTGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1201398177 Y:13571831-13571853 GATTCAAAATAAAGGCATGGAGG + Intergenic
1201974841 Y:19837963-19837985 GACTCAAAACAAAGGGATGGAGG - Intergenic