ID: 1072549108

View in Genome Browser
Species Human (GRCh38)
Location 10:96463690-96463712
Sequence GGTCCCAAGGGAGCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072549108_1072549115 11 Left 1072549108 10:96463690-96463712 CCAGCTCCAGCTCCCTTGGGACC 0: 1
1: 0
2: 2
3: 26
4: 316
Right 1072549115 10:96463724-96463746 ATACAGGATGCCATCTAGCAGGG No data
1072549108_1072549112 -5 Left 1072549108 10:96463690-96463712 CCAGCTCCAGCTCCCTTGGGACC 0: 1
1: 0
2: 2
3: 26
4: 316
Right 1072549112 10:96463708-96463730 GGACCTTCGTCTACACATACAGG No data
1072549108_1072549117 27 Left 1072549108 10:96463690-96463712 CCAGCTCCAGCTCCCTTGGGACC 0: 1
1: 0
2: 2
3: 26
4: 316
Right 1072549117 10:96463740-96463762 AGCAGGGCAGACGCAGCTCACGG No data
1072549108_1072549114 10 Left 1072549108 10:96463690-96463712 CCAGCTCCAGCTCCCTTGGGACC 0: 1
1: 0
2: 2
3: 26
4: 316
Right 1072549114 10:96463723-96463745 CATACAGGATGCCATCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072549108 Original CRISPR GGTCCCAAGGGAGCTGGAGC TGG (reversed) Intronic
900113859 1:1020473-1020495 GTCGCCAAGGGAGCCGGAGCGGG - Intronic
900154225 1:1197659-1197681 GGCACCAAGGGAGGTGGCGCAGG - Exonic
900308689 1:2023250-2023272 GGACTCAAGAGGGCTGGAGCCGG + Intronic
900498672 1:2988998-2989020 GCCCCCAAGGGAGCTGTTGCTGG + Intergenic
900532681 1:3162451-3162473 ACTCCCAAGAGAGCTGCAGCAGG + Intronic
901022299 1:6261410-6261432 GGGCCAGAGGGAGCTGGGGCAGG + Intergenic
901057165 1:6453993-6454015 GGCCACAGGGGAGCTGGAGAAGG + Intronic
901530749 1:9851059-9851081 GGCCCCAGGTGACCTGGAGCAGG + Intronic
902477201 1:16694500-16694522 GGCCACAGGGGAGCTGGAGAAGG - Intergenic
902766420 1:18619134-18619156 GGGCCCAAGGCTGGTGGAGCTGG - Intergenic
903337836 1:22636744-22636766 GGACCCAGGGGAGCTGGCCCAGG + Intronic
903813016 1:26045519-26045541 TGTCCCAAGTGCGCTGGAGGGGG - Intronic
903943641 1:26948475-26948497 GGTCAGATGGGAGCTGGAGTGGG + Intergenic
906668528 1:47638536-47638558 GGATTCAGGGGAGCTGGAGCTGG + Intergenic
907976283 1:59434491-59434513 GGGCCCAAGGGAACTAGAGAGGG + Intronic
912748979 1:112269806-112269828 GTTCCAGAGGGAGCTGAAGCAGG + Intergenic
912900913 1:113647291-113647313 CCTTCCAAGGGAGCTGGAGTTGG + Intronic
915367894 1:155325570-155325592 GGTTCCAAGGGAGCGGGTGCTGG - Exonic
916662467 1:166935330-166935352 GGTGCCAAGGGAGGTGGATGCGG + Exonic
918216092 1:182392420-182392442 AGACCCAAGAGAGCCGGAGCGGG - Intergenic
918221110 1:182437272-182437294 CGTCCAAAGGTAGCAGGAGCGGG - Intergenic
923918573 1:238537351-238537373 GGTCCTAAGAGTGGTGGAGCTGG + Intergenic
924437440 1:244054764-244054786 GGTCTTGAGGGAGCTGGACCGGG + Exonic
924440778 1:244083434-244083456 GGGGCCAGAGGAGCTGGAGCAGG + Intergenic
1065639411 10:27766691-27766713 GGGCAGAAGGGAGCTGGACCAGG - Intergenic
1067504834 10:46840546-46840568 GGTCCCACAGGAGCTGGCGGGGG + Intergenic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1068754243 10:60632775-60632797 GGTCCCTAGGAGGCTGAAGCAGG + Intronic
1069100247 10:64310912-64310934 GGTCCCAAGAGTGGTGGGGCTGG + Intergenic
1069445703 10:68471659-68471681 GGTGCCCAGGGAGCTGCACCGGG + Intronic
1069611043 10:69772704-69772726 GGTGGCAAGGGAGAAGGAGCAGG - Intergenic
1069793057 10:71035626-71035648 GGCCCCAAGGCAGCTGGAAGTGG + Intergenic
1069898776 10:71695283-71695305 GCTCCCAAGGTTGGTGGAGCTGG + Intronic
1070565617 10:77601933-77601955 GAAATCAAGGGAGCTGGAGCTGG - Intronic
1070678618 10:78433322-78433344 GGCCCCCACTGAGCTGGAGCTGG - Intergenic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1072625892 10:97111727-97111749 GCTCCCAGGTGAGCTGCAGCAGG - Intronic
1072637594 10:97187627-97187649 GGGCCCCATGGAGCAGGAGCTGG - Intronic
1073920179 10:108449573-108449595 GGGGCCGAGGGACCTGGAGCAGG - Intergenic
1075681894 10:124339246-124339268 TGCCCCAAGTGGGCTGGAGCTGG + Intergenic
1076221632 10:128738501-128738523 GGGCCAAAGGGAGCCGGAGGCGG - Intergenic
1076252187 10:128993720-128993742 GGACCCAGAGGGGCTGGAGCAGG - Intergenic
1076406501 10:130215588-130215610 GCCTCCAAGGAAGCTGGAGCTGG - Intergenic
1077415262 11:2421770-2421792 GGTCCCAGGTGAGTGGGAGCAGG + Intronic
1077430130 11:2512246-2512268 GGCCCTACGGGTGCTGGAGCCGG + Intronic
1079158700 11:17973259-17973281 GGTCCCACAGGAGCAGGATCAGG + Intronic
1080673129 11:34399742-34399764 GGTCCTGTGGGAGCTGGAACTGG - Intergenic
1081992746 11:47346534-47346556 GGGGCCAAGGGAGCTGAAGAGGG + Intronic
1084760211 11:71266116-71266138 GGACCCAAGGCAGGTGGAGGAGG - Intergenic
1085257481 11:75183953-75183975 GGTCCCAGTGAAGATGGAGCAGG + Intronic
1085274898 11:75292083-75292105 GCTCCCAGGGGAGGTGGGGCGGG - Intronic
1085310505 11:75513898-75513920 GGTGCCATGGGAGCTGCCGCAGG + Intronic
1085390478 11:76179556-76179578 GGCCCCATGGGTGCTGCAGCTGG - Intergenic
1085529521 11:77183236-77183258 GGGCCCACGGAAGCAGGAGCAGG + Intronic
1087375602 11:97336043-97336065 GGTCCCAAAGCTGCTGCAGCTGG - Intergenic
1087609825 11:100420935-100420957 AGTCTAAAGGGAACTGGAGCTGG - Intergenic
1089848721 11:121479202-121479224 GGCCCCCAGGGAGGTGGAGGCGG + Intronic
1090411352 11:126511983-126512005 GATGCCCAGGAAGCTGGAGCTGG + Intronic
1091230471 11:133984774-133984796 GGTGCAAAGGGAGCAGGGGCCGG + Intergenic
1091571388 12:1690029-1690051 GGTCTTGAGGGAGCTGGAGTCGG - Intronic
1096199829 12:49673614-49673636 GGGGCCAAGGCAGCAGGAGCTGG - Intronic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1097867319 12:64569510-64569532 ATCCCCAAGGGAGATGGAGCTGG - Intergenic
1097896175 12:64825895-64825917 GGTCCCCAAGGCGCTGGCGCTGG - Intronic
1098443926 12:70546826-70546848 AGTCCCAGGGAAGCTGGAGGAGG + Intronic
1101327751 12:103731426-103731448 GGTCAGAAGAGAGTTGGAGCAGG + Intronic
1102301029 12:111771456-111771478 TTTCCCAATGGAGCTCGAGCTGG - Intronic
1102504446 12:113374793-113374815 GGTCCCCAGAGAGCTGCAGCAGG - Exonic
1102521046 12:113477582-113477604 GGTCCCTCTGGAGCTGCAGCAGG + Intergenic
1102642615 12:114380178-114380200 GGAGCCAAAGGGGCTGGAGCTGG - Intronic
1104081001 12:125430538-125430560 GCTCCCAGGGAAGGTGGAGCTGG + Intronic
1104665789 12:130646425-130646447 GGTGGCAAGGGAGGTGGAGAGGG - Intronic
1105407898 13:20146451-20146473 GGGCCTAAAGGATCTGGAGCAGG - Intronic
1107464349 13:40635853-40635875 GGTCCCCAGGGAGGGGCAGCAGG - Intronic
1109867980 13:68291316-68291338 AGCCACAATGGAGCTGGAGCAGG - Intergenic
1111456901 13:88496204-88496226 GGTTCCAACTGAGCTGGACCTGG + Intergenic
1113400606 13:109989257-109989279 GCACCCCAGGGAGCTGGAGCTGG - Intergenic
1113835492 13:113326026-113326048 GGTCCTCGGGGAGCTGGTGCGGG - Exonic
1114527733 14:23377010-23377032 GGTCTCTAGGGGGCTGGTGCAGG + Exonic
1114613745 14:24057760-24057782 GGTCTCAGGGGAGCTGGAAGGGG - Intronic
1116820473 14:49621607-49621629 GGCCCCCCGGGAGCTGGTGCTGG + Exonic
1121241062 14:92430536-92430558 GGGCCCAGGGAAGCTGGAGGAGG - Intronic
1122794310 14:104198362-104198384 GGTCTCAACGGAGCCTGAGCTGG + Intergenic
1123040619 14:105488822-105488844 AGTGCCAAGGGAGCTGCAGTGGG + Intronic
1125134787 15:36328808-36328830 GGTGCGAAGGGAGCTGTAACAGG - Intergenic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1128700691 15:69801889-69801911 AGTCCCAAGGCAGGTGAAGCTGG + Intergenic
1129720144 15:77873429-77873451 GGTCCCAAGGGAAGGGGAGAAGG - Intergenic
1130011772 15:80157887-80157909 TGGCACAAGGGAGCTGGGGCAGG + Intronic
1130062036 15:80577254-80577276 GGACCCAAGTGAGCTGGAGCTGG + Intronic
1130652885 15:85772345-85772367 GGTGCCTAGGGACCTAGAGCAGG - Intronic
1131180205 15:90234079-90234101 GGTCCTAGGCGAGCTGGAGGCGG + Exonic
1132302829 15:100787132-100787154 GGGGCCATGTGAGCTGGAGCAGG - Intergenic
1132304550 15:100801904-100801926 GGTCCCTAGGGGGCTGCAGTGGG + Intergenic
1132381245 15:101368271-101368293 GGCCCCAGGGGAGCGGGAGAGGG + Intronic
1132689977 16:1178012-1178034 GGTCCCCAGGGAGAGGGAGTGGG - Intronic
1132690024 16:1178105-1178127 GGTCCCCAGGGAGAGGGGGCGGG - Intronic
1132703487 16:1231523-1231545 AGTCCACAGGGAGCTGGGGCCGG - Intergenic
1132865124 16:2089512-2089534 CTTCCCAAGGGAGCTGGGGAGGG + Exonic
1132945270 16:2528765-2528787 GGTCCCCAAGGGGCTGGACCGGG + Intronic
1132957194 16:2600642-2600664 TGTCCCAAGAGGGCTGGAGTAGG - Exonic
1132969537 16:2679054-2679076 TGTCCCAAGAGGGCTGGAGTAGG - Intergenic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133071094 16:3247198-3247220 GGTGCAGAGGAAGCTGGAGCAGG - Exonic
1134640826 16:15827954-15827976 GGCCCCAGAGGAGCTGGAGATGG - Intronic
1135572297 16:23558095-23558117 GGTCCCCAGGGGGCTGGGCCGGG - Exonic
1136030578 16:27499815-27499837 GGGGCCATGTGAGCTGGAGCTGG - Intronic
1136228021 16:28872050-28872072 GATCCCGAGGGAGCTGGCCCAGG + Intronic
1136419504 16:30123119-30123141 GGTCCCGGGGGAGGTGGAGATGG - Exonic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1137615884 16:49846707-49846729 GGTCCCCAGGGAGAGGGAGAGGG - Intronic
1137647712 16:50090240-50090262 GGTCCCAAGGAAGCTGAAGTGGG + Intronic
1138489281 16:57366813-57366835 GGTCCCAGGGGCCCTGGAGGTGG + Intergenic
1138522592 16:57579418-57579440 GAACCCAGGGGCGCTGGAGCTGG + Intronic
1138544509 16:57707678-57707700 GGTGCCTAGGGAGGGGGAGCTGG + Exonic
1139752855 16:69119884-69119906 GGTCCCATGGGCCCTGGATCTGG - Exonic
1139845685 16:69919597-69919619 GGTCCACAGTGAGCTGGAGGTGG + Intronic
1141203320 16:81913864-81913886 GGTCCCCAGGGAGGTGGCTCAGG - Intronic
1141686253 16:85571627-85571649 GGGCCACAGGGACCTGGAGCAGG + Intergenic
1142155735 16:88532194-88532216 GATCTCCAGGGAGCTGGCGCTGG - Exonic
1142903796 17:3029273-3029295 GGGCGGAAGGGACCTGGAGCGGG + Intronic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143653987 17:8282456-8282478 AGTCCCAGGGAAGCTGAAGCAGG - Intergenic
1144265404 17:13563442-13563464 GGGGCCAAGGGAATTGGAGCAGG + Intronic
1144675447 17:17158684-17158706 GGAGCCTGGGGAGCTGGAGCGGG + Exonic
1144855255 17:18263990-18264012 GGTGCCACTGGTGCTGGAGCCGG + Exonic
1144949305 17:18985445-18985467 GGGCCCAAAGGAGCTGGGGCAGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1150056713 17:62023504-62023526 GGACACAAGGGAGCTGCTGCTGG + Intronic
1151161022 17:72166064-72166086 CATCCCAAGGGAGCTGCAGGAGG + Intergenic
1151272214 17:73005586-73005608 GGTCCCTAGGTGGCTGGAGCGGG - Intronic
1151599906 17:75099869-75099891 AGTCCCCAGGGACTTGGAGCTGG + Intronic
1152627477 17:81394174-81394196 GGTCCCGCGGGAGCGGGAGTGGG + Intergenic
1153882512 18:9433710-9433732 GATGTCAAGGGAGCTGCAGCAGG - Intergenic
1155991013 18:32279375-32279397 GATCTCACAGGAGCTGGAGCTGG - Intronic
1157684568 18:49631889-49631911 GGTCCCAAGAGATCTGGAGGTGG - Intergenic
1157706876 18:49814258-49814280 GGGGCCAGGGGACCTGGAGCAGG + Intronic
1157897009 18:51478846-51478868 CTTCCCAAGGGTGCTGGGGCTGG + Intergenic
1159369834 18:67516398-67516420 GGCCCCAAGGGAGACGGAGGTGG + Exonic
1160907266 19:1457216-1457238 GGGCCCGAGGGAGGTGGCGCCGG + Exonic
1161316246 19:3618968-3618990 GGTCTACATGGAGCTGGAGCAGG - Exonic
1161809897 19:6465593-6465615 GTTGCCATCGGAGCTGGAGCTGG - Exonic
1162029611 19:7911714-7911736 GCTGCCACAGGAGCTGGAGCTGG + Intronic
1162321075 19:9970836-9970858 GGTCCCCAGAGAGGTGAAGCGGG + Intronic
1162346216 19:10119519-10119541 GGTCCCAAGGAGGATGGCGCGGG + Intronic
1162789216 19:13054436-13054458 GGTTCCTAGGGGGCTGGAGGTGG + Intronic
1162792976 19:13072521-13072543 GCTCCTCTGGGAGCTGGAGCTGG + Intronic
1163186530 19:15642699-15642721 GGCCCCAAGAGAGATAGAGCAGG + Intronic
1163218213 19:15896316-15896338 GGACCCAAGAGAGATAGAGCAGG - Intronic
1163404240 19:17112583-17112605 GGTCCCAAGGGAGGAGGAGAGGG + Intronic
1163715587 19:18870449-18870471 GGTCCCAGGGGAGGTGGCGGCGG + Exonic
1163764158 19:19153122-19153144 GGTCCCACGAGAGCAGCAGCAGG + Intronic
1164547928 19:29184443-29184465 AGTTCCAAGAGAGCAGGAGCTGG - Intergenic
1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG + Intronic
1165243151 19:34482586-34482608 GCTCACCCGGGAGCTGGAGCGGG + Exonic
1165507912 19:36245950-36245972 GACCCCAAGGCTGCTGGAGCCGG + Intronic
1165830679 19:38728837-38728859 GGGGCCAAGGCTGCTGGAGCAGG + Intronic
1165944810 19:39435745-39435767 GGTAACATGGGAGCTGGAGCCGG - Intronic
1166336973 19:42114167-42114189 GGTCCCTGGGGAGCTGGGGGAGG + Intronic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1167475903 19:49700874-49700896 GGTCCCAGGAGAGCCTGAGCAGG - Intronic
1167596912 19:50432719-50432741 GGTCCCCAGGGAGGAGGGGCTGG - Intergenic
1168144883 19:54415441-54415463 GGGCTCAGGGGAGCGGGAGCGGG - Intronic
1168312001 19:55465114-55465136 GCTCCCAAAGGGGCTGGTGCGGG + Intergenic
1168339589 19:55615502-55615524 GGGCGCAGGGCAGCTGGAGCCGG - Exonic
1202711217 1_KI270714v1_random:20326-20348 GGCCACAGGGGAGCTGGAGAAGG - Intergenic
925669409 2:6294700-6294722 GATCCCAAGAGAGATGGGGCTGG - Intergenic
926007764 2:9385897-9385919 GGTAAGAAGGGAGCTGGAGGAGG - Intronic
926388467 2:12362397-12362419 AATCCCAAGGGAGTTGGGGCAGG - Intergenic
926757854 2:16250376-16250398 GTGCCCAGGGGAGCTGGAACTGG - Intergenic
929958850 2:46480813-46480835 AGTCCCATGGGGCCTGGAGCAGG + Intronic
930455928 2:51607285-51607307 GATCACAAGGGAGATGAAGCAGG + Intergenic
931377050 2:61717255-61717277 GGTCCCAAAGGTGCTGCAACTGG + Intergenic
933899504 2:86839581-86839603 GCTGCCCAGGGAGCTGGAGCAGG - Intronic
934661313 2:96145093-96145115 GGTCCGCGGGGAGCTGGCGCGGG - Exonic
935482242 2:103605585-103605607 GGACCCAAATGTGCTGGAGCTGG + Intergenic
935629558 2:105201936-105201958 GGTCTCAAGGGGGCTGGAGATGG - Intergenic
935781057 2:106509645-106509667 GCCACCCAGGGAGCTGGAGCAGG + Intergenic
940116863 2:150219228-150219250 TGCCCCATGGGAGGTGGAGCCGG + Intergenic
940887048 2:158999233-158999255 GGGCCCCAGGGAGCTGCAGATGG - Intronic
942965874 2:181891947-181891969 GGGCCCCGGGGAGCTGAAGCGGG - Exonic
945265277 2:207884876-207884898 ACTCCAAAGGGACCTGGAGCAGG - Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947418668 2:229922314-229922336 GGTCACCCGGGACCTGGAGCTGG + Intronic
947523094 2:230863587-230863609 TTTCCCATGGGATCTGGAGCAGG + Intergenic
948114082 2:235480830-235480852 GGTGAGAAGAGAGCTGGAGCTGG + Intergenic
948422941 2:237871598-237871620 GGGCCCAAGGGAGTTGGGGTCGG - Intronic
948602435 2:239115094-239115116 GCCCCCACGGGAGGTGGAGCCGG - Exonic
948798659 2:240420229-240420251 GGTCCCAAGGAAGCTTGATGGGG + Intergenic
948934455 2:241153608-241153630 GTCCCCAAGGGAGCTGGGCCTGG - Intronic
1169131544 20:3168456-3168478 GGTCCACAGGGAGCGGGAGAGGG - Intronic
1169194389 20:3675386-3675408 GTTCCCAGGGGACCTGCAGCAGG + Intronic
1169476911 20:5939953-5939975 GATCCCAAAGGAGCGGCAGCTGG - Intronic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1172893969 20:38286636-38286658 GGAGCCCAGGGAGCTGGAGAGGG + Intronic
1172909385 20:38395273-38395295 AGTCCCAAGGGAGCTGAGTCTGG - Intergenic
1173430598 20:42983873-42983895 GGACCCATGGGAGATGGAGATGG - Intronic
1174403808 20:50291137-50291159 TGTACCAAGGGGGCTGGGGCTGG + Intergenic
1175170459 20:57076711-57076733 GGACCCAAAGGAGCTGGAACAGG - Intergenic
1175212119 20:57366405-57366427 AATCCCAAGGGAGCAGGAGATGG + Intronic
1175715284 20:61251535-61251557 AGGGCAAAGGGAGCTGGAGCTGG + Intergenic
1179152683 21:38822246-38822268 TCTCCCAAGGGAACTGGAGGCGG - Intronic
1179867945 21:44227964-44227986 AGTCCCAAGGGGGCAGGAGACGG - Intronic
1180206002 21:46261028-46261050 GGTGTCAGGGGAGCTGGAGTAGG - Intronic
1181866939 22:25865925-25865947 TGTTCCAAGGGAGCTGTAGGTGG - Intronic
1181879270 22:25964829-25964851 GGTCGCAGGGCAGCTGGAGAAGG + Intronic
1183400677 22:37602120-37602142 GGTCCTTGGGGAGCTAGAGCAGG + Intergenic
1183744875 22:39686354-39686376 GCTCCCCGGAGAGCTGGAGCCGG + Exonic
1183943423 22:41309648-41309670 AGTCACAAGGAAGCTGAAGCAGG - Intronic
1184115045 22:42417401-42417423 GGTCCCATGGGATCTGGGGCAGG + Intronic
1184274011 22:43400035-43400057 GGTCACCTGGGAGCTGGGGCTGG + Intergenic
1184288517 22:43485948-43485970 GGCCCCAAGGGCAGTGGAGCTGG + Intronic
1184593316 22:45500052-45500074 AGTCCCAATGGGGATGGAGCAGG - Intergenic
1184648310 22:45908012-45908034 GGACCCCAGGGAGCTGAGGCCGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185258137 22:49848122-49848144 GGTCACGAAGGTGCTGGAGCCGG - Intergenic
1185419360 22:50726912-50726934 GGGCCCATCAGAGCTGGAGCTGG + Intergenic
949202362 3:1394310-1394332 GGCTCCACTGGAGCTGGAGCTGG + Intronic
950094131 3:10318557-10318579 GACCCCAAGGGAGCTACAGCTGG + Intronic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
952339511 3:32433591-32433613 GGTCACAAGGGACCTTGTGCTGG + Intronic
952817525 3:37458550-37458572 GATCCCAAGAAAGCTGCAGCTGG + Intronic
953626904 3:44579285-44579307 GGAGCCTGGGGAGCTGGAGCGGG - Intronic
954303160 3:49711890-49711912 GGGCCCAAGAGAGCTGGCGATGG - Intronic
954371637 3:50172086-50172108 GGCCCCAAGGCACCTGGAGGGGG - Intronic
957553335 3:81734954-81734976 GATCCCAGGTGAGATGGAGCTGG - Intronic
957875980 3:86147190-86147212 GCTCTCTGGGGAGCTGGAGCAGG - Intergenic
961481605 3:127184156-127184178 GGTGCCGAGGCAGCTGGAGGGGG - Intergenic
961483169 3:127196959-127196981 GGCACCAAGGCAGCTGGAGGGGG - Exonic
961530253 3:127536213-127536235 GGTTCCAAGGGACATGGAGCAGG - Intergenic
962457356 3:135576950-135576972 GGTTCCCAAAGAGCTGGAGCAGG - Intergenic
962637183 3:137343185-137343207 GTTCCCAAGGGAGCAGTAACAGG - Intergenic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
966124235 3:176556788-176556810 GCTCCCAAGGGAACAGGAGGTGG - Intergenic
966904082 3:184509126-184509148 GCTCCCAGGGAAGCTGCAGCTGG + Intronic
968086744 3:195877282-195877304 GGGCCCAAGGGTGAGGGAGCCGG + Intronic
968089995 3:195893684-195893706 GGTGCCTGGGGAGCTGGAGAGGG - Intronic
968150842 3:196335578-196335600 GGGCCCAAGGGTCCTGGGGCAGG + Intronic
968809057 4:2792079-2792101 GAACCCAAGGGAGCTGGGGGTGG - Intergenic
969722010 4:8897323-8897345 GACCCCCTGGGAGCTGGAGCAGG - Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
971146334 4:23980677-23980699 GGACCCAAGGCATTTGGAGCCGG + Intergenic
972290969 4:37689533-37689555 GGGCCCAAGGGAGCTGATCCTGG - Intergenic
972471548 4:39410662-39410684 GGTCACAAGGGGGCAGGAGAAGG - Intronic
972847872 4:43011339-43011361 GGTCAGAGGGAAGCTGGAGCAGG + Intronic
974499665 4:62684032-62684054 GATCCCAAGGGAGGGGCAGCCGG + Intergenic
975655931 4:76641326-76641348 TGTCCCAAGGGAGGATGAGCAGG - Intronic
976362774 4:84199600-84199622 TGTCCTAAGAGAGATGGAGCAGG + Intergenic
982714337 4:158791080-158791102 GGTAACAAGGGAGGTGGAGGAGG + Intronic
983000581 4:162409154-162409176 GCTCCCAAGGTAGCAGGCGCTGG + Intergenic
984157519 4:176210014-176210036 TGTCCCAAAGGACCTGGATCCGG + Intergenic
984686797 4:182678523-182678545 GGTCACAAGAGAGGTGGAGTAGG + Intronic
985164794 4:187081966-187081988 CCTCCCAAGGGAGCAGGAACTGG - Intergenic
986720057 5:10554477-10554499 GGTCCCTAGAGTGCTGGAGTGGG + Intergenic
986897874 5:12392821-12392843 GGTCCCAGGAGACCTGGAGTAGG - Intergenic
988916271 5:35896516-35896538 GGTCACAAGGGAACTGTAGCTGG - Intergenic
990324289 5:54659786-54659808 GGCACCAATGGAGCTGAAGCAGG + Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
991515919 5:67435261-67435283 GGTCCCAAGTGAACTGAAACTGG + Intergenic
992124499 5:73626496-73626518 GCTCCCGAGGGAGCGGGAGGCGG - Intronic
995051959 5:107716993-107717015 AGGCCAGAGGGAGCTGGAGCTGG - Intergenic
997848460 5:137309429-137309451 GGTTCCTAGGGAGCTGGAGTGGG - Intronic
998897297 5:146813554-146813576 GGTCCTCAGTGAGCTGAAGCAGG + Intronic
998936992 5:147239915-147239937 TGTCCAAAGGGAGCTGCAGTTGG + Intronic
1001523577 5:172413125-172413147 AGTCCCAGCGGAGCCGGAGCAGG + Intronic
1001630287 5:173169979-173170001 GGTTGCAAGGGAGAAGGAGCAGG - Intergenic
1002784416 6:391260-391282 GGTCCAAAGAGAACTGGAGGTGG - Intergenic
1005947652 6:30606074-30606096 GGACACAAGGGAGCAGGAGGGGG - Intronic
1006181309 6:32154876-32154898 GTTCCTCAGGGAGCTGGTGCTGG + Intronic
1006339836 6:33440732-33440754 GTTCCCGAGGGAGCTGAAGGAGG + Exonic
1006389543 6:33750433-33750455 GGTGACACTGGAGCTGGAGCTGG - Intergenic
1007311265 6:40947832-40947854 AGTCCTGAGGGAGCGGGAGCTGG - Intergenic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1007703063 6:43775477-43775499 AGTCCCATGGGAGGTGGAGGCGG - Intronic
1009413418 6:63392388-63392410 GGTCCCTTTGGAGCTGGAGCTGG - Intergenic
1013130934 6:107232005-107232027 GGTACAATAGGAGCTGGAGCTGG - Intronic
1015268630 6:131316132-131316154 GCTCCTAAGGGGGCTGAAGCAGG - Intergenic
1016885412 6:148955222-148955244 GGCACCAAGGGAGCTGGGTCTGG + Intronic
1017687560 6:156928443-156928465 GGGCCCAAGGGAGAAGGAACAGG + Intronic
1019179719 6:170178673-170178695 GGAACCCAGCGAGCTGGAGCTGG + Intergenic
1019181882 6:170192524-170192546 GGTCCCAAGAGAGCAGGGCCTGG - Intergenic
1019359837 7:599032-599054 GGACCCAGGGAAGCTGGACCAGG + Intronic
1019523850 7:1472069-1472091 GGGCCCAGGGGAGCTGGAGGTGG - Intronic
1020111665 7:5451265-5451287 GGACCCAGAGGAGCTGGAGGGGG - Intronic
1020140768 7:5610507-5610529 GGTCCCAAGGGAGCCGAAATGGG - Intergenic
1020617341 7:10476403-10476425 CGGCCCAGGGGTGCTGGAGCCGG - Intergenic
1021024101 7:15643307-15643329 GCTGCCAAGGTAGCTGGAGGTGG + Intronic
1021501727 7:21339249-21339271 GGTCCCTAGGGTACTAGAGCAGG - Intergenic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023091777 7:36624587-36624609 GTTCCCTTGGGAACTGGAGCTGG + Intronic
1023905598 7:44519641-44519663 GGCCCTAAGGGAGCTCGTGCTGG - Intronic
1027124500 7:75546719-75546741 TGTGCGAAGGGAGCTGGAGTTGG + Intronic
1029599050 7:101553248-101553270 GGCCCCCAGGGAACTGGAGAGGG + Intronic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1032074860 7:128831482-128831504 GGGCCGAGGGGAGCTGGCGCGGG + Intronic
1032239442 7:130149578-130149600 GGTCCCCAGGCAGCAGGATCTGG - Intergenic
1034163209 7:149007314-149007336 GCTCTCATGGGACCTGGAGCAGG - Intronic
1035121566 7:156572811-156572833 CCTCCCAAGGGAGCGGGACCTGG + Intergenic
1035234012 7:157484581-157484603 GATCCCCAGGGAGCTGCCGCGGG - Intergenic
1035828336 8:2668330-2668352 GGTCCCAGAGGACCGGGAGCAGG + Intergenic
1037086159 8:14853365-14853387 GGTCCCAAGGGAACTGCATTTGG - Intronic
1037422457 8:18717841-18717863 GTTCGTAAGGGAGCTAGAGCAGG - Intronic
1037959106 8:23083252-23083274 AGGCACAAGGGAGCTGGGGCTGG - Intergenic
1038422113 8:27440099-27440121 GGACCCCAGGGTGCTGGAGGAGG + Intronic
1039391349 8:37183317-37183339 GGCCCCAAATGAGCTTGAGCTGG + Intergenic
1039905342 8:41782123-41782145 GGGCCCAAGTGAGATGGAGCTGG - Intronic
1047097267 8:121639376-121639398 GGTCCCAAGGGTGAGGGAGTGGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049219325 8:141421674-141421696 TGGCCCAAGGCAGCTGGAGTTGG + Exonic
1049258764 8:141627701-141627723 GGTCCCAGGGAGGCCGGAGCGGG - Intergenic
1049463614 8:142741218-142741240 GGCCACACAGGAGCTGGAGCAGG + Exonic
1049741328 8:144242440-144242462 GGCCCCCCGGGAGCTGGTGCTGG + Exonic
1049872840 8:144994495-144994517 GAACTCAGGGGAGCTGGAGCTGG - Intergenic
1056638477 9:88350334-88350356 AGCCTCAAGGGACCTGGAGCAGG - Intergenic
1056768528 9:89460180-89460202 GGACCCAAGGGGCCTGGAGAAGG - Intronic
1057131034 9:92654876-92654898 GGTTCCAACGGAGCTGAGGCTGG + Intronic
1059335524 9:113566301-113566323 GGAGCCAAGGGAGCAGGTGCAGG - Intronic
1060255980 9:122031428-122031450 GGGAGCCAGGGAGCTGGAGCCGG - Intronic
1060286900 9:122261655-122261677 TGTCCCAAGGGAACTGGTTCTGG - Intronic
1060530794 9:124346154-124346176 GGTCCCGAGGGTGCTGAACCTGG + Intronic
1060921237 9:127422106-127422128 GCTACTCAGGGAGCTGGAGCAGG - Intergenic
1061513642 9:131076046-131076068 GGACTCAAGGGAGCTGGCTCTGG - Intronic
1061678452 9:132231132-132231154 GGTCCCAGGGGAGTCGGACCAGG + Intronic
1061858650 9:133456731-133456753 GCACCCAAGGGAGGTGGAGAAGG - Intronic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1202799631 9_KI270719v1_random:163490-163512 TGGCCCAGGGGTGCTGGAGCCGG + Intergenic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185593750 X:1294881-1294903 GGTCTCCATGGAGGTGGAGCAGG - Intronic
1187900884 X:24025687-24025709 GGCGCCACGGGAGCGGGAGCGGG + Intronic
1189794529 X:44634213-44634235 GGTCCCATGGGCCCTGGATCTGG + Intergenic
1189963755 X:46350710-46350732 GGACCCATGGGAGCTGCACCTGG + Intergenic
1190485492 X:50919435-50919457 GGTGCAAAAGGAGCAGGAGCAGG + Intergenic
1192195050 X:69022435-69022457 AGTCCCCAGGGAGCTTGATCTGG + Intergenic
1193264556 X:79453190-79453212 GGTCTCAAGGCAGCTGGAGTTGG - Intergenic
1193798363 X:85905144-85905166 GATTCCAAGGGAGTGGGAGCAGG - Intronic
1196828374 X:119758397-119758419 GGTACCCAGGGAAGTGGAGCTGG + Intergenic
1199606489 X:149583487-149583509 GGTCCCATGTGTGCTGGGGCAGG + Intronic
1199632633 X:149785881-149785903 GGTCCCATGTGTGCTGGGGCAGG - Intronic
1200010216 X:153114766-153114788 GGGCCCAAGAGAGCTGCAGTGGG + Intergenic
1200029384 X:153285156-153285178 GGGCCCAAGAGAGCTGCAGTGGG - Intergenic
1200150661 X:153949878-153949900 AGCCCCAGGGGAGCTGGAGCAGG + Intronic
1200284221 X:154805233-154805255 AGTCCCAAGGGCGCTGGGCCGGG - Intronic
1201310947 Y:12597795-12597817 GGTAGCAAGGGGGCTGGAGGAGG + Intergenic