ID: 1072550303

View in Genome Browser
Species Human (GRCh38)
Location 10:96472231-96472253
Sequence ACGTCAGGCTGGACTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072550303_1072550307 23 Left 1072550303 10:96472231-96472253 CCAGCAAGAGTCCAGCCTGACGT No data
Right 1072550307 10:96472277-96472299 TCCCTTCTGTAGGATATCATAGG No data
1072550303_1072550306 13 Left 1072550303 10:96472231-96472253 CCAGCAAGAGTCCAGCCTGACGT No data
Right 1072550306 10:96472267-96472289 CGAGACATCGTCCCTTCTGTAGG No data
1072550303_1072550309 24 Left 1072550303 10:96472231-96472253 CCAGCAAGAGTCCAGCCTGACGT No data
Right 1072550309 10:96472278-96472300 CCCTTCTGTAGGATATCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072550303 Original CRISPR ACGTCAGGCTGGACTCTTGC TGG (reversed) Intronic
No off target data available for this crispr