ID: 1072551957

View in Genome Browser
Species Human (GRCh38)
Location 10:96485883-96485905
Sequence ACATCGGACACTTTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072551957_1072551964 10 Left 1072551957 10:96485883-96485905 CCCAAAGAAAAAGTGTCCGATGT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1072551964 10:96485916-96485938 AATGGCAATGGCAGGCAATCAGG No data
1072551957_1072551963 2 Left 1072551957 10:96485883-96485905 CCCAAAGAAAAAGTGTCCGATGT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1072551963 10:96485908-96485930 ATTATGGCAATGGCAATGGCAGG No data
1072551957_1072551960 -8 Left 1072551957 10:96485883-96485905 CCCAAAGAAAAAGTGTCCGATGT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1072551960 10:96485898-96485920 TCCGATGTCAATTATGGCAATGG No data
1072551957_1072551962 -2 Left 1072551957 10:96485883-96485905 CCCAAAGAAAAAGTGTCCGATGT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1072551962 10:96485904-96485926 GTCAATTATGGCAATGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072551957 Original CRISPR ACATCGGACACTTTTTCTTT GGG (reversed) Intronic
903255238 1:22093452-22093474 ATATGGGATACATTTTCTTTAGG + Intergenic
907623409 1:56005429-56005451 ACATCTGACACCATTTCTTAGGG + Intergenic
909184172 1:72464362-72464384 AAATCAGAGACTTTTTCTATAGG + Intergenic
909924540 1:81423926-81423948 AGATTGAACACTTTTTCTTCAGG - Intronic
910360113 1:86407765-86407787 ATATTGTACACTTTTTGTTTTGG + Intergenic
911059509 1:93735442-93735464 ACATCAGGCACTTTTGCTTTCGG + Intronic
912775690 1:112505078-112505100 ACAGTGGACCCTTCTTCTTTGGG + Intronic
912839527 1:113026605-113026627 ACATAGAACACTCTTTATTTAGG + Intergenic
916231154 1:162542623-162542645 ACATCTGACTATTTTTTTTTTGG - Intergenic
918527011 1:185475791-185475813 AAATCAGTAACTTTTTCTTTTGG + Intergenic
919562646 1:199141089-199141111 ACTTAGGACACTTTCCCTTTGGG + Intergenic
920527731 1:206680176-206680198 ATATCTGTCACTTTTGCTTTGGG + Intronic
921135074 1:212252806-212252828 ACACACGAGACTTTTTCTTTGGG + Intergenic
1063051999 10:2460814-2460836 ACATCTGACACATATTATTTGGG - Intergenic
1065728618 10:28690889-28690911 ACATTGGCCATTTTTTTTTTTGG + Intergenic
1068854387 10:61782503-61782525 ACTTCGGGCATTTTCTCTTTTGG + Intergenic
1071874467 10:89829722-89829744 GCATAGGTCACTTTATCTTTGGG - Intergenic
1072511725 10:96133299-96133321 ATATCAGATAATTTTTCTTTAGG - Intronic
1072551957 10:96485883-96485905 ACATCGGACACTTTTTCTTTGGG - Intronic
1073603665 10:104871583-104871605 ACAACAGACATTTTTTCTTATGG + Intronic
1073949384 10:108788646-108788668 ATATCTGACAATTTTACTTTGGG - Intergenic
1075472539 10:122703160-122703182 AAATTGAACACTTTTTCTATTGG + Intergenic
1075571617 10:123550625-123550647 AAATCGCACACTTTGTCTTATGG - Intergenic
1076058773 10:127396725-127396747 AGATATGACATTTTTTCTTTAGG - Intronic
1078696220 11:13634893-13634915 ACATCTGGCAATTTTTCTTTGGG + Intergenic
1079824971 11:25179440-25179462 ACATTGCTCTCTTTTTCTTTTGG + Intergenic
1081552832 11:44130061-44130083 ACATCTGACATCTTTTCTTCTGG - Exonic
1084841351 11:71852916-71852938 TCATCAGACTCTTTTTTTTTTGG - Intergenic
1086942234 11:92810107-92810129 ACAGTGGACACTTTGTCTTCAGG + Intronic
1093143029 12:15532435-15532457 ACATGGGACAATTTGTCTTTTGG + Intronic
1093555162 12:20464154-20464176 ATACAGGGCACTTTTTCTTTTGG - Intronic
1094302499 12:28980946-28980968 ACATTGAACAGTTTTTATTTGGG - Intergenic
1095309598 12:40682565-40682587 TCATATGACACTTTTTCTGTAGG + Intergenic
1097046428 12:56190191-56190213 CCATCCGACTCTTTTTCTTTGGG + Intergenic
1097994983 12:65878457-65878479 AAAGCGCACACTTTTTCTTTTGG + Intronic
1099394458 12:82120924-82120946 CCATAGGAGACTTTGTCTTTAGG + Intergenic
1108723476 13:53156257-53156279 ATATAGGATACTTTTTTTTTAGG - Intergenic
1109386031 13:61629912-61629934 ACATAGCAAAATTTTTCTTTTGG + Intergenic
1118786575 14:69050559-69050581 ACATCAGAAAATATTTCTTTGGG + Intergenic
1124422375 15:29534035-29534057 ACATATGACACTCTTTCTGTGGG - Intronic
1127301450 15:57658002-57658024 ACATTGGACATTTTTTCTTACGG + Intronic
1130020655 15:80228626-80228648 AAATCTGAAACTTTTTTTTTTGG + Intergenic
1135323639 16:21512665-21512687 ACTTCTGACCCTTTTTCCTTGGG - Intergenic
1135866733 16:26109881-26109903 ACATCACACACTTTTTTTTGTGG + Intronic
1144910182 17:18674261-18674283 ACCTTAGACACATTTTCTTTGGG + Intronic
1150988079 17:70222022-70222044 ACATCAAACACTTTTATTTTGGG + Intergenic
1163461668 19:17441707-17441729 ACATGGGGGACTTTTTTTTTTGG + Intronic
1163909318 19:20175702-20175724 ACATGGGAGACTTTTCATTTTGG - Intronic
1166659963 19:44640367-44640389 ACATCTGACATTTTCTTTTTTGG + Intergenic
1167893759 19:52564123-52564145 AAATCGGACGATTTTACTTTTGG - Intronic
925454619 2:4004597-4004619 AGGTCTGACACTTGTTCTTTTGG + Intergenic
927890466 2:26744950-26744972 ACAGAGGACACCTTTTCTTGGGG - Intergenic
938630173 2:133158103-133158125 AAATCGGACACTTGTCCTTTAGG + Intronic
940898659 2:159105846-159105868 CCATTGGTAACTTTTTCTTTTGG + Intronic
942611574 2:177747363-177747385 ACTTTGGACACATTTGCTTTTGG + Intronic
942757498 2:179359326-179359348 ACATCATACACTTTATATTTGGG + Intergenic
942780498 2:179636009-179636031 GCATCATACATTTTTTCTTTGGG - Intronic
945875434 2:215273344-215273366 CCATAGAACATTTTTTCTTTTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1174336092 20:49861880-49861902 ACCTCGGACATTTCTTCTTTGGG + Intronic
1176007571 20:62874804-62874826 ACACCTCACACTTTCTCTTTTGG - Intergenic
1177208397 21:18038062-18038084 ACATCTGGTACTTTCTCTTTTGG + Intronic
1178127756 21:29533892-29533914 ACATTTGTCACTTTTTCCTTTGG + Intronic
1180555891 22:16573497-16573519 GGATTGGGCACTTTTTCTTTTGG + Intergenic
1182826897 22:33273519-33273541 ACACCGGTCACATTTTCTATTGG - Exonic
1184402754 22:44283299-44283321 AGGTGGGACACTTTTCCTTTTGG - Intronic
1185118127 22:48949506-48949528 ACAGCGGAAATTTTTTCTCTTGG + Intergenic
949775982 3:7632994-7633016 GCTTCGGACACATTTCCTTTAGG - Intronic
952304851 3:32136572-32136594 ACTTCAGATACATTTTCTTTGGG + Intronic
955786274 3:62542751-62542773 ACATCACACACTTATCCTTTTGG - Intronic
956832531 3:73066312-73066334 ACAGTGGATACTTTTTCTATTGG + Exonic
957740624 3:84263407-84263429 ACATAAGACAATTTTTATTTTGG + Intergenic
958465834 3:94456878-94456900 AGATAGTTCACTTTTTCTTTTGG + Intergenic
958844210 3:99245766-99245788 AAATAGGTCACTTTTTTTTTTGG - Intergenic
960932291 3:122865454-122865476 ACAGCAGTCACTTTTTTTTTAGG + Intronic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
963736596 3:149024121-149024143 ACTTTTGACACTTTTTGTTTTGG - Exonic
966368570 3:179220022-179220044 GGATTGGGCACTTTTTCTTTTGG + Exonic
968050319 3:195649443-195649465 ACAGTGGATACTTTTTCTATTGG - Intergenic
968097000 3:195939317-195939339 ACAGTGGATACTTTTTCTATTGG + Intergenic
968105510 3:195998816-195998838 ACAGTGGATACTTTTTCTATTGG + Intergenic
968303788 3:197636398-197636420 ACAGTGGATACTTTTTCTATTGG + Intergenic
971633621 4:29028700-29028722 ACATTGGACACAGTGTCTTTGGG + Intergenic
974557230 4:63466585-63466607 ATATCAGACACTTTTTCTGTTGG - Intergenic
977695464 4:99960064-99960086 ACATATGACTCTTTTTCCTTTGG - Intergenic
979278276 4:118836683-118836705 ACTTCCCACACTTTTCCTTTGGG - Intronic
981034642 4:140156784-140156806 ACATGTAACAGTTTTTCTTTTGG - Intergenic
982374890 4:154678986-154679008 ACATCACACACCTTTTTTTTTGG + Intronic
985507068 5:288210-288232 ACAGTGGATACTTTTTCTATTGG - Intronic
985740902 5:1616884-1616906 ACAGTGGATACTTTTTCTATTGG + Intergenic
986690107 5:10307147-10307169 ACATTCGACAGCTTTTCTTTAGG - Intronic
988137677 5:27195886-27195908 ACATTCAAAACTTTTTCTTTTGG + Intergenic
990088128 5:52004119-52004141 ACAAAGGGCAGTTTTTCTTTGGG + Intergenic
990091277 5:52052807-52052829 ACATCTAACACTTTTGCATTGGG + Intronic
991190483 5:63867497-63867519 ACTTAGGACACATTTTCATTTGG + Intergenic
993348516 5:86817307-86817329 ACATATGACATTTTTTCATTAGG + Intergenic
994856015 5:105120006-105120028 ACATCGGTCACTTGTGTTTTGGG + Intergenic
997595545 5:135104906-135104928 ACAGGGGACACTTTGTGTTTTGG + Intronic
1004487799 6:16083777-16083799 ACATCTGATACCTTTTCTATTGG - Intergenic
1005829026 6:29655778-29655800 ACAGCGGCCACTTTTTCCATGGG + Intergenic
1007139948 6:39561950-39561972 ACATAGGAGACTTCTTGTTTCGG - Intronic
1008085643 6:47241359-47241381 TCATCTGAAACTTTTTTTTTAGG - Intronic
1008423489 6:51330035-51330057 ACATAGGACACTGTTTGTATTGG - Intergenic
1009766548 6:68084599-68084621 ACATTGTACAATTTTTCTTTGGG - Intergenic
1012386027 6:98684079-98684101 AGATCAGACACCTATTCTTTAGG - Intergenic
1014805439 6:125824331-125824353 ACTTGGGAGACTTTTGCTTTTGG + Intronic
1015230396 6:130908560-130908582 ACATCTGACATTTTTTTTCTGGG - Intronic
1015716131 6:136194057-136194079 ACATCTGACATATTCTCTTTTGG - Exonic
1020609779 7:10380753-10380775 TCATGGGACACTTTTTATTATGG - Intergenic
1025044615 7:55682280-55682302 ACCCTGGACACTTTTTCTTATGG + Intergenic
1030768731 7:113445274-113445296 ACATTTGGCACATTTTCTTTAGG - Intergenic
1031398827 7:121306495-121306517 ACATCTGCCACCATTTCTTTAGG - Intergenic
1032877582 7:136054039-136054061 ACATCAGGCTCTTTTTGTTTTGG + Intergenic
1034147797 7:148887659-148887681 TCTTCAGACAGTTTTTCTTTTGG - Intergenic
1036624831 8:10461214-10461236 TGATCAGACACTATTTCTTTTGG + Intergenic
1036787939 8:11700411-11700433 GCCTCGGACACTCTTTCTTGGGG - Intronic
1036836617 8:12075171-12075193 TCATCAGACTCTTTTTTTTTTGG + Intergenic
1036858460 8:12321738-12321760 TCATCAGACTCTTTTTTTTTTGG + Intergenic
1037427286 8:18770140-18770162 ACATCTGTCCCTTTTACTTTAGG + Intronic
1039087382 8:33793423-33793445 ACATCATAGCCTTTTTCTTTCGG + Intergenic
1042517725 8:69677375-69677397 CCATTGGCTACTTTTTCTTTTGG - Intronic
1042919174 8:73905657-73905679 ACTTTTGACACTTTTTGTTTTGG + Intergenic
1046733384 8:117750156-117750178 ACATCGGAAAATTTCCCTTTGGG + Intergenic
1048719106 8:137301987-137302009 ATATGGCACACTTCTTCTTTGGG + Intergenic
1050013990 9:1213499-1213521 ACATCACACACATTCTCTTTTGG - Intergenic
1050375916 9:4972714-4972736 TCATCGAACAATTTTTCTCTTGG + Intergenic
1058147114 9:101424546-101424568 ACCTAGGATACTTTTTATTTTGG - Intronic
1059478599 9:114570277-114570299 ACATGGGAGACTTTTTCTTCAGG + Intergenic
1060566476 9:124597157-124597179 TCATTGGTCACTTTCTCTTTAGG - Intronic
1062593475 9:137286214-137286236 AAATCTGATGCTTTTTCTTTTGG - Intergenic
1189456676 X:41197082-41197104 ACATCTGATACTTTTTACTTAGG + Intronic
1192991874 X:76467913-76467935 ACATCGTAAACTTTTGCTTCAGG - Intergenic
1193068221 X:77279926-77279948 ACATGGGAGACTTTTCATTTTGG + Intergenic
1193379818 X:80805962-80805984 AGATGGGATACTTTTTCTTGGGG - Intronic
1194085634 X:89524543-89524565 AAATAGGACACTGTGTCTTTTGG + Intergenic
1195416742 X:104628558-104628580 ATATATAACACTTTTTCTTTGGG + Intronic
1197658466 X:129143957-129143979 ACATAGGAAAATTTTTCTTGTGG - Intergenic
1198347225 X:135770421-135770443 TCATAGAACACATTTTCTTTTGG + Intergenic
1198349131 X:135787683-135787705 TCATAGAACACATTTTCTTTTGG + Intergenic
1198351037 X:135804955-135804977 TCATAGAACACATTTTCTTTTGG + Intergenic
1198352943 X:135822220-135822242 TCATAGAACACATTTTCTTTTGG + Intergenic
1198354852 X:135839476-135839498 TCATAGAACACATTTTCTTTTGG + Intergenic
1198356763 X:135856758-135856780 TCATAGAACACATTTTCTTTTGG + Intergenic
1198358676 X:135874038-135874060 TCATAGAACACATTTTCTTTTGG + Intergenic
1200438278 Y:3180425-3180447 AAATAGGACACTGTGTCTTTTGG + Intergenic