ID: 1072552114

View in Genome Browser
Species Human (GRCh38)
Location 10:96487008-96487030
Sequence GTGAACAATACGAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072552114_1072552119 -10 Left 1072552114 10:96487008-96487030 CCTGCAGTCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1072552119 10:96487021-96487043 TATTGTTCACCTGGGGAGGCAGG No data
1072552114_1072552121 29 Left 1072552114 10:96487008-96487030 CCTGCAGTCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1072552121 10:96487060-96487082 ACTTTTAAGCCAGAAAGACCTGG No data
1072552114_1072552122 30 Left 1072552114 10:96487008-96487030 CCTGCAGTCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1072552122 10:96487061-96487083 CTTTTAAGCCAGAAAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072552114 Original CRISPR GTGAACAATACGAAGACTGC AGG (reversed) Intronic
903970626 1:27116636-27116658 GTGGACAGTACAAAGACTGGGGG - Intronic
913135900 1:115888835-115888857 GTGTAGAATGGGAAGACTGCAGG - Intergenic
1063980537 10:11448254-11448276 GTGAAATAAACGAAGTCTGCTGG + Intergenic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1099727181 12:86447018-86447040 ATGAACAATACGAAGGCTAAGGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG + Exonic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1120610073 14:86628706-86628728 GTGAACAAAGCAAAGACTGAGGG - Intergenic
1124686124 15:31783475-31783497 GTGAAGAATATGAAGACTACTGG - Intronic
1127605112 15:60579105-60579127 ATGAAGAATACCATGACTGCTGG + Intronic
1129805293 15:78451577-78451599 GTAAACAATACGAGTACTACAGG + Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1136595656 16:31247808-31247830 GTGGACAAGACAAAGAATGCTGG - Intergenic
1137507156 16:49064154-49064176 GGGGACAATAAGAAGAATGCAGG - Intergenic
1137762592 16:50952631-50952653 GTGGACAAAACGAAGGCTGCTGG + Intergenic
1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG + Intergenic
1144383994 17:14731741-14731763 GTGAAAAACAGGAAGACTACTGG - Intergenic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1152089017 17:78236830-78236852 GTGACCAATACCAAGGCTGCTGG - Intronic
1152782827 17:82233788-82233810 GGGAACAGGACGCAGACTGCGGG - Exonic
1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG + Intronic
1156710683 18:39941234-39941256 GTGAGCAATAGAAAGACAGCTGG + Intergenic
925394607 2:3524136-3524158 GTGAAAAACACAATGACTGCTGG + Intergenic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
929000264 2:37341533-37341555 GTGAAAAATACTAAGATGGCTGG + Intergenic
929450844 2:42035993-42036015 GTGAATAAAACGATGAATGCTGG - Intergenic
930541067 2:52707261-52707283 GTGAAATATACAAAGACTGAAGG - Intergenic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
939932521 2:148253321-148253343 ATGTACAATAGGAAAACTGCTGG + Intronic
940765973 2:157789951-157789973 GAGAACAATATGAAGTCTTCAGG + Intronic
1180566537 22:16672093-16672115 GTAAACAATATGCAGACTGAAGG - Intergenic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
955921941 3:63966323-63966345 GTGAACAATACTAAGACCTGTGG + Intronic
957450361 3:80373532-80373554 GTTAACAATATGAAGAATGAAGG - Intergenic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
963450592 3:145476358-145476380 GTGAATGAAAAGAAGACTGCAGG - Intergenic
969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG + Intergenic
973333506 4:48933395-48933417 GTGAACAAATCGAAGCTTGCTGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG + Intergenic
981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG + Intergenic
991243654 5:64486421-64486443 GTGAACAATGCCAACACTCCTGG - Intergenic
999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1011609423 6:89136018-89136040 GTGGGCAATAAGAATACTGCTGG + Intergenic
1018946523 6:168350315-168350337 GTGTACAACATGAGGACTGCGGG - Intergenic
1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG + Intronic
1021880969 7:25095026-25095048 GTGAACAAAACCCAGACTGTGGG - Intergenic
1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG + Intronic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1031050200 7:116937147-116937169 GTGAACAAAACAAAGACCCCTGG - Intergenic
1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG + Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1048641003 8:136361474-136361496 ATGAACAAATTGAAGACTGCAGG - Intergenic
1050413373 9:5389213-5389235 GTGAAAAATAGTAAGGCTGCAGG + Intronic
1051155777 9:14143946-14143968 GTGCACATTACGAAGTCTTCAGG + Intronic
1052998817 9:34566090-34566112 GTTAACACCACCAAGACTGCAGG + Intronic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1188475177 X:30584206-30584228 GTGAACAAAACAAAAAGTGCTGG + Intergenic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1191025707 X:55910562-55910584 GTGGACAAGAGGAAGAGTGCGGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193826841 X:86236734-86236756 ATGAACAATATGTGGACTGCAGG + Intronic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1201894456 Y:18978734-18978756 GTTAAAAATACCAAGACAGCTGG - Intergenic