ID: 1072552119

View in Genome Browser
Species Human (GRCh38)
Location 10:96487021-96487043
Sequence TATTGTTCACCTGGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072552114_1072552119 -10 Left 1072552114 10:96487008-96487030 CCTGCAGTCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1072552119 10:96487021-96487043 TATTGTTCACCTGGGGAGGCAGG No data
1072552110_1072552119 26 Left 1072552110 10:96486972-96486994 CCCTTGCAGGGAAATCCTTTACG 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1072552119 10:96487021-96487043 TATTGTTCACCTGGGGAGGCAGG No data
1072552113_1072552119 11 Left 1072552113 10:96486987-96487009 CCTTTACGAAGGCACTTTCTGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1072552119 10:96487021-96487043 TATTGTTCACCTGGGGAGGCAGG No data
1072552111_1072552119 25 Left 1072552111 10:96486973-96486995 CCTTGCAGGGAAATCCTTTACGA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1072552119 10:96487021-96487043 TATTGTTCACCTGGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072552119 Original CRISPR TATTGTTCACCTGGGGAGGC AGG Intronic
No off target data available for this crispr