ID: 1072552121

View in Genome Browser
Species Human (GRCh38)
Location 10:96487060-96487082
Sequence ACTTTTAAGCCAGAAAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072552114_1072552121 29 Left 1072552114 10:96487008-96487030 CCTGCAGTCTTCGTATTGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1072552121 10:96487060-96487082 ACTTTTAAGCCAGAAAGACCTGG No data
1072552120_1072552121 7 Left 1072552120 10:96487030-96487052 CCTGGGGAGGCAGGCTCATTAAA 0: 1
1: 0
2: 2
3: 14
4: 132
Right 1072552121 10:96487060-96487082 ACTTTTAAGCCAGAAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072552121 Original CRISPR ACTTTTAAGCCAGAAAGACC TGG Intronic
No off target data available for this crispr