ID: 1072552183

View in Genome Browser
Species Human (GRCh38)
Location 10:96487424-96487446
Sequence CTGTATTCCTTTAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072552178_1072552183 0 Left 1072552178 10:96487401-96487423 CCCCGACACACTCTTTCCTTTCT 0: 1
1: 0
2: 1
3: 25
4: 354
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552173_1072552183 18 Left 1072552173 10:96487383-96487405 CCACTATTTGCCCTCCCACCCCG 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552172_1072552183 24 Left 1072552172 10:96487377-96487399 CCATCACCACTATTTGCCCTCCC 0: 1
1: 0
2: 1
3: 20
4: 247
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552176_1072552183 4 Left 1072552176 10:96487397-96487419 CCCACCCCGACACACTCTTTCCT 0: 1
1: 0
2: 1
3: 34
4: 273
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552177_1072552183 3 Left 1072552177 10:96487398-96487420 CCACCCCGACACACTCTTTCCTT 0: 1
1: 0
2: 1
3: 40
4: 300
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552180_1072552183 -2 Left 1072552180 10:96487403-96487425 CCGACACACTCTTTCCTTTCTCT 0: 1
1: 0
2: 7
3: 93
4: 927
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552174_1072552183 8 Left 1072552174 10:96487393-96487415 CCCTCCCACCCCGACACACTCTT 0: 1
1: 3
2: 7
3: 33
4: 394
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552179_1072552183 -1 Left 1072552179 10:96487402-96487424 CCCGACACACTCTTTCCTTTCTC 0: 1
1: 0
2: 0
3: 61
4: 537
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data
1072552175_1072552183 7 Left 1072552175 10:96487394-96487416 CCTCCCACCCCGACACACTCTTT 0: 1
1: 0
2: 3
3: 78
4: 507
Right 1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072552183 Original CRISPR CTGTATTCCTTTAGGACAAA TGG Intronic
No off target data available for this crispr