ID: 1072553443

View in Genome Browser
Species Human (GRCh38)
Location 10:96496314-96496336
Sequence ACCAGCATGCTGTAGGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072553443_1072553447 15 Left 1072553443 10:96496314-96496336 CCTATGCCCTACAGCATGCTGGT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1072553447 10:96496352-96496374 TTACCCATTTGTTCCAGCTAAGG No data
1072553443_1072553448 16 Left 1072553443 10:96496314-96496336 CCTATGCCCTACAGCATGCTGGT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1072553448 10:96496353-96496375 TACCCATTTGTTCCAGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072553443 Original CRISPR ACCAGCATGCTGTAGGGCAT AGG (reversed) Intronic
901022974 1:6264312-6264334 CCGAGCACGCTGTAGGGTATGGG - Exonic
901414944 1:9110184-9110206 ACCAGAGTGCTGTATAGCATGGG - Intronic
901915022 1:12492276-12492298 ACCACTATGCTGTAGGCTATAGG + Intronic
902229844 1:15021125-15021147 ACCCGCATGCTGTGTGGCCTTGG - Intronic
904491700 1:30864492-30864514 ACCGGCATGCTGTAAGGAAAGGG - Intergenic
905807940 1:40890499-40890521 ACCTCCATCCTGGAGGGCATGGG - Intergenic
910485694 1:87711041-87711063 CCCAGCATGCTGTAGGAGAGTGG - Intergenic
910516799 1:88070653-88070675 AGTAGCATGCTGTAGAGCAATGG - Intergenic
913260344 1:116991978-116992000 TTCAGCAAGCTCTAGGGCATAGG + Intergenic
915466470 1:156101450-156101472 TCCAGCAGGCTGGAGTGCATTGG - Intronic
915827745 1:159096758-159096780 ACCAGCAGGCTGGAGAGCACAGG + Intronic
917856813 1:179107938-179107960 ACCAGCTGGCTGTTGGGCACAGG + Exonic
918129267 1:181610781-181610803 AACTGCATGCTGTTGTGCATGGG - Intronic
918906928 1:190508297-190508319 TACAGAATGCTGTAAGGCATGGG + Intergenic
919787976 1:201272197-201272219 ACCAACTTGCTGTATGGCTTTGG - Intergenic
920852046 1:209634613-209634635 ATCAGCATGCCGGCGGGCATGGG + Exonic
921363539 1:214352703-214352725 ACCATAAGGCTGTAGGCCATTGG + Exonic
921995665 1:221415191-221415213 ACCAACTTGCTGGAGGTCATGGG + Intergenic
923329705 1:232911281-232911303 TTCAGCAGGCTCTAGGGCATAGG - Intergenic
923602444 1:235414977-235414999 ACCAGCACGCTCCACGGCATAGG - Intronic
1064888264 10:20137568-20137590 ACCACCCTGCTCTAAGGCATAGG + Intronic
1067759219 10:49030520-49030542 CCCAGCATGCTCTAGGACAGTGG + Intronic
1070080704 10:73183886-73183908 ACTTACATGCTGTTGGGCATAGG - Intronic
1070358502 10:75663811-75663833 AACACCATGCTGTTGGGAATAGG - Intronic
1070451715 10:76565091-76565113 ACCAGCAGGCTGTGTGGAATTGG + Intergenic
1071333593 10:84584502-84584524 ACCAGGATGCTGTGAGGGATGGG - Intergenic
1072553443 10:96496314-96496336 ACCAGCATGCTGTAGGGCATAGG - Intronic
1078311404 11:10246931-10246953 CCCAGCATGGTGCTGGGCATGGG + Intronic
1084084987 11:66850880-66850902 ACCAGCATGGTGCAGGCCGTGGG + Exonic
1084872677 11:72108738-72108760 ACCTGCTGGCAGTAGGGCATGGG - Exonic
1085642494 11:78201190-78201212 CCCAGCCTGGTGGAGGGCATGGG - Intronic
1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG + Intronic
1089782734 11:120884894-120884916 AGTAGCATGCTGGAGGGCAGGGG - Intronic
1093707200 12:22287735-22287757 TCCAGCAAGCTGTATGGCAAGGG + Intronic
1102447492 12:113014900-113014922 GCCTGCATGCTGGAGGGCTTCGG + Intergenic
1103607275 12:122096658-122096680 AGCAGCCTGCTGTGGGGCAGGGG + Intronic
1107293737 13:38887930-38887952 TCCAGCAGTCTCTAGGGCATAGG + Intergenic
1107836486 13:44416065-44416087 ACCAGCAGGCAGTTGGTCATTGG - Intergenic
1114790871 14:25656887-25656909 ACCAGTCTGTTGTAGGGCCTGGG + Intergenic
1118118029 14:62803462-62803484 ACCAGCCTTCTGTAAGGCTTGGG + Intronic
1118128002 14:62930679-62930701 AACAGCATTCTGTAGTGCACAGG - Intronic
1118699206 14:68416729-68416751 ACCAGCCTGCTGTAGTCTATGGG + Intronic
1122860991 14:104582315-104582337 ACCAGCCTGCAGTGGGGCGTGGG - Intronic
1128906186 15:71469727-71469749 ACCAGCATGGTGGAGATCATGGG - Intronic
1129117482 15:73373056-73373078 ACAAGCTTGCTGTAGAGCTTGGG - Intergenic
1129821339 15:78604030-78604052 TCCAGGATGCTGTATGGAATTGG - Intronic
1131380030 15:91955860-91955882 ACCAGCTTTCTTTAGGGCAGAGG + Intronic
1132502198 16:289503-289525 ACCAGGGTGCGGTAGGGGATGGG + Exonic
1134227154 16:12399981-12400003 ACCAGCCTGCAGCAGGACATGGG - Intronic
1135593060 16:23718741-23718763 ACCAGCAGGCAAGAGGGCATGGG - Intergenic
1137448600 16:48549684-48549706 ACCAGCCTGGTGCAGGGCAAGGG + Intronic
1139435182 16:66932778-66932800 ACCTGCATGCTCTGAGGCATGGG + Exonic
1140609463 16:76580846-76580868 ACCAACATTCTGAAGGTCATCGG - Intronic
1144761842 17:17711473-17711495 TCCAGCATGCCGTAGGCCCTTGG - Intronic
1145129733 17:20333170-20333192 ACCATCATGCTCTAGGAGATGGG + Intergenic
1146212034 17:30950331-30950353 ACCCGCATGGTGTAGGGCAGAGG + Intronic
1146505295 17:33399557-33399579 GCCAGCATGCTGTGGGGAACAGG - Intronic
1147319954 17:39640087-39640109 TCCAGCATACTGTAGGCCCTTGG + Intronic
1147457364 17:40546140-40546162 GTCAGCAGGCTGCAGGGCATAGG + Intergenic
1148169384 17:45506405-45506427 ACTGCCCTGCTGTAGGGCATGGG - Intergenic
1148365974 17:47056257-47056279 ACTGCCCTGCTGTAGGGCATAGG + Intergenic
1149807148 17:59629333-59629355 ACCAGAATGCTGTTTGGCAAAGG + Intronic
1149855985 17:60083294-60083316 ACCACCATGCTATAATGCATAGG + Intergenic
1150892881 17:69174723-69174745 ACCAGTATGCTGAAGGCCAGAGG + Exonic
1151276691 17:73039871-73039893 ACCAGCTTGCTCTGGGGCTTTGG - Intronic
1151582695 17:74989060-74989082 CCCAGCTTGCTGGAGGCCATGGG - Intronic
1153747477 18:8194621-8194643 ATCAGCATGATTTATGGCATAGG + Intronic
1154150438 18:11902318-11902340 ACCAGTATGGTGAAGGGCCTGGG + Intronic
1161027634 19:2043932-2043954 ACCAGGATGCTGGAGTGCAATGG - Intronic
1165390716 19:35537140-35537162 ACCAGCATGCTGCTGAGCATGGG - Intronic
1167732299 19:51267247-51267269 ACCAGCTTGCTGTATGACCTAGG - Intronic
926344856 2:11935900-11935922 AGCAGCAGGCTTTGGGGCATAGG + Intergenic
931227321 2:60342782-60342804 GCCAGTATGCTGTAGGGCTAGGG + Intergenic
932573099 2:72948620-72948642 GCCAGCATGCTCTAGGGAGTGGG - Intronic
937295438 2:120807193-120807215 ACCAGCATGGTCTGGGGGATGGG + Intronic
1170567284 20:17614410-17614432 ACCATCATCCTGCAGGGCAGGGG + Intronic
1170909719 20:20553638-20553660 AGCAGCATGCTTTAGGGAATGGG + Intronic
1173860928 20:46283084-46283106 TACAGCATGCAGTACGGCATGGG + Intronic
1175792666 20:61751601-61751623 GCCAGCATGCTGTAGCCCACAGG + Intronic
1179678887 21:43003730-43003752 CCCAGCATGCTGCCTGGCATGGG + Intronic
1181909645 22:26228484-26228506 ACCAGCATGGTGCTGGGCAATGG + Intronic
1182510123 22:30813729-30813751 ACCAGCCTTGTGTAGGGCAGTGG + Intronic
1184419121 22:44369366-44369388 GCCAGCACTCTGTAGGGCATTGG + Intergenic
1184813197 22:46851451-46851473 ACCAGCAGGCTCTCGGGCACAGG - Intronic
953901613 3:46846872-46846894 ACCAGCAGGCTGTGAGGCAGTGG + Intergenic
961949173 3:130729297-130729319 ACCACCATGCTCTAGTGCTTAGG + Intronic
964479151 3:157124980-157125002 AACAGCCTGCTATAGGGCAGTGG - Intergenic
965721987 3:171672130-171672152 ACCAGCATGCTGTAAGAGTTTGG - Intronic
967380109 3:188848342-188848364 ACCAGCATACTGCATGGAATGGG + Intronic
968778706 4:2562408-2562430 GCCACCATGCTGTAGTGCAGTGG - Intronic
969826635 4:9763116-9763138 ACCAGACTATTGTAGGGCATGGG + Intergenic
971165675 4:24180847-24180869 CCCAAAATGCTGTGGGGCATTGG - Intergenic
974285971 4:59867767-59867789 ACCAGCATGGTGGAAGGCAAAGG - Intergenic
975961489 4:79912924-79912946 ACCAGCATGCTGCAGGTAATGGG + Intronic
981750915 4:148091662-148091684 ACCAGCCTGATGTAGTGCACGGG + Intronic
988706454 5:33730635-33730657 ACTAGCTTGCTGTAGGTCAATGG - Intronic
991021665 5:61985698-61985720 ACCAGGATGTTGTAGGGAAGAGG - Intergenic
991085861 5:62647957-62647979 ACTAGCATGCTGTATGACCTTGG - Intergenic
994469212 5:100181220-100181242 ACCACCATGCTGGACGACATTGG - Intergenic
995722245 5:115149003-115149025 AATAGCATGCTATATGGCATTGG + Intronic
996628252 5:125596990-125597012 GCTAGCATGCAGTAGGGCTTGGG - Intergenic
997283686 5:132663801-132663823 ACCAGCTAGATGAAGGGCATAGG - Intergenic
1005816892 6:29560428-29560450 TCCAGCATGCTGTCAGGCACAGG + Intronic
1006686413 6:35838244-35838266 CCCATCATTCTGTAGGACATTGG + Intronic
1010811884 6:80310257-80310279 ACCAGCCTGATGCAGGGCTTTGG - Intronic
1011989897 6:93501499-93501521 ACCATAATGCTGTATGGCAAAGG + Intergenic
1013612848 6:111811340-111811362 AGTAGCAGGCTGTAGGGCTTGGG + Intronic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1013930743 6:115529302-115529324 ACCAGCATGCACAAAGGCATGGG - Intergenic
1015199832 6:130566734-130566756 ACCATCATGGTGGAGGGCAAAGG + Intergenic
1022586392 7:31617034-31617056 ACCACCATGCTGTGGTGCCTAGG - Intronic
1030064905 7:105652146-105652168 GCCCTCATGCAGTAGGGCATAGG + Intronic
1032186210 7:129728867-129728889 ACCAGAATGCTGTAGGACAAAGG + Intronic
1035372852 7:158390533-158390555 ACCATCGTGCTGGAGGGCCTCGG + Intronic
1037758255 8:21725321-21725343 AACAGCATGCTGAAGGGCCTCGG + Intronic
1038375557 8:27036734-27036756 TCCAGCATTGTGGAGGGCATGGG + Intergenic
1038481891 8:27907530-27907552 TCCAGCATGCTGAAGGGCAAAGG - Intronic
1045234003 8:100333882-100333904 AACATCATGCTGTAGGGAACAGG - Intronic
1045249689 8:100473185-100473207 CCCAGGATGCCGGAGGGCATGGG + Intergenic
1047297723 8:123586129-123586151 CCCAGCATGCTATATGGCAGGGG + Intergenic
1047718254 8:127615636-127615658 AGCAGCATGCAGAAAGGCATTGG - Intergenic
1048248634 8:132837958-132837980 AACAGCATGCTATATGCCATAGG + Intronic
1049248693 8:141576735-141576757 ACCAGCATCCGGCAGGGCTTGGG - Intergenic
1049454942 8:142682050-142682072 AGCAGCCGGCTGCAGGGCATGGG - Exonic
1050321231 9:4454507-4454529 AACAGCAAGATGTAGGGCAAAGG - Intergenic
1050571069 9:6939550-6939572 CCCAGCATGCTTTAAGGCAGTGG - Intronic
1051876938 9:21803057-21803079 ACCCGCACCCTGTAGGGCGTAGG + Intronic
1055499696 9:76890537-76890559 ATTAGCATGCTGTGGGGCAGGGG - Intronic
1058971455 9:110087112-110087134 ACCAGCATGGTGGAGAGAATTGG - Intronic
1060270957 9:122141139-122141161 AATAGCATGCTGTAGAGTATAGG + Intergenic
1061623688 9:131827896-131827918 GCCAGCATGATGTGGGGCAGGGG + Intergenic
1186303616 X:8229052-8229074 AACAGCATGGTTTAGGGCAGAGG + Intergenic
1188282840 X:28291371-28291393 TGCAGAATGCTGGAGGGCATAGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1197341634 X:125282880-125282902 ACAATCATGGTGTAGGGCAAAGG + Intergenic
1198174975 X:134146084-134146106 CCCAGCATGCTGCAGACCATTGG + Intergenic