ID: 1072553594

View in Genome Browser
Species Human (GRCh38)
Location 10:96497476-96497498
Sequence CTCGGGTTTCCTCCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072553585_1072553594 18 Left 1072553585 10:96497435-96497457 CCAGGAAGCGTGCTTCTGTGGAC 0: 1
1: 0
2: 2
3: 5
4: 94
Right 1072553594 10:96497476-96497498 CTCGGGTTTCCTCCAGCTTCTGG No data
1072553589_1072553594 -10 Left 1072553589 10:96497463-96497485 CCTCCAGTTTCCCCTCGGGTTTC 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1072553594 10:96497476-96497498 CTCGGGTTTCCTCCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072553594 Original CRISPR CTCGGGTTTCCTCCAGCTTC TGG Intronic
No off target data available for this crispr