ID: 1072558781

View in Genome Browser
Species Human (GRCh38)
Location 10:96548982-96549004
Sequence CTTATTCATCTCTCCAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072558774_1072558781 25 Left 1072558774 10:96548934-96548956 CCATTTTTATCTACATTGAAAAA 0: 1
1: 0
2: 7
3: 103
4: 847
Right 1072558781 10:96548982-96549004 CTTATTCATCTCTCCAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072558781 Original CRISPR CTTATTCATCTCTCCAAGAT GGG Intronic
No off target data available for this crispr