ID: 1072559334

View in Genome Browser
Species Human (GRCh38)
Location 10:96556278-96556300
Sequence CAGGTAAGAGGCAGTATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072559334_1072559337 1 Left 1072559334 10:96556278-96556300 CCAACAATACTGCCTCTTACCTG 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1072559337 10:96556302-96556324 TATGTGCCAAACACTGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072559334 Original CRISPR CAGGTAAGAGGCAGTATTGT TGG (reversed) Intronic
901199868 1:7460614-7460636 CAGGTGAGAGGCAGAACTGGGGG - Intronic
904849223 1:33444757-33444779 CATGAAAGAGGCAGCATTTTTGG + Intergenic
905851531 1:41278463-41278485 CAGAGAAGGGGCAGTTTTGTTGG + Intergenic
907258940 1:53201709-53201731 CAGGTAACTGGCATTGTTGTTGG + Intronic
908307132 1:62831749-62831771 CATGTAAGAGGCTGTATCTTTGG - Intronic
913336355 1:117712167-117712189 CAGCCCAGAGGCAGTATTGGGGG - Intergenic
917780219 1:178387147-178387169 CAGGTGAGTGGTATTATTGTGGG + Intronic
918612255 1:186506369-186506391 CAGGTATGAGGCACCATTGGTGG + Intergenic
919322262 1:196058204-196058226 CAGAAGAGAGGAAGTATTGTGGG - Intergenic
920255663 1:204652381-204652403 CAGGTAAGAGGCAGCTGTTTAGG + Intronic
923221838 1:231902291-231902313 TATGTAACAGGCAGTATTCTAGG + Intronic
924053289 1:240099116-240099138 CATGTACCAGGCAGAATTGTAGG - Intronic
1065034721 10:21625996-21626018 CAGGACAGAGGAAGTATGGTGGG - Intronic
1065192251 10:23223578-23223600 AAGGTAAGAATCATTATTGTTGG - Exonic
1066791768 10:39072908-39072930 CAGGTAAGAAACACTATTTTTGG + Intergenic
1070014206 10:72509289-72509311 AAAGTAAGAGGCAGCATTGCAGG + Intronic
1072321457 10:94254075-94254097 CCAGGAAGAGGCAGTATTGAAGG + Intronic
1072559334 10:96556278-96556300 CAGGTAAGAGGCAGTATTGTTGG - Intronic
1075391602 10:122096394-122096416 CCGGTAAGGGGCACTCTTGTAGG - Intronic
1076614304 10:131745985-131746007 CAGAAAAGAGGCAGTGTCGTCGG + Intergenic
1081743801 11:45459175-45459197 CGTGCAAGAGGCACTATTGTTGG - Intergenic
1082612389 11:55316952-55316974 CAGGTACCAGCCAGTATTCTAGG + Intergenic
1085828425 11:79873196-79873218 GAAGTGAGAGGCAGTCTTGTGGG - Intergenic
1088202965 11:107359939-107359961 GAGGTAAGAGGAAGTATGGCTGG + Intronic
1089067951 11:115676310-115676332 CAGGGAAGAGGAAGGTTTGTGGG - Intergenic
1090264698 11:125346717-125346739 CAGCTAAGAGGCAGTCATGAGGG - Intronic
1090801402 11:130174807-130174829 CAGGGAAGAGTCTGTAATGTGGG - Intronic
1091334077 11:134753674-134753696 CAGGTAAGGAGAAGGATTGTGGG - Intergenic
1095833736 12:46615049-46615071 CAGGTGAGAGGGGGTCTTGTTGG + Intergenic
1095922573 12:47545376-47545398 CATGGGAGAGGCAGTATTGGAGG + Intergenic
1097592829 12:61592353-61592375 GTGGTAAGAGGCGATATTGTGGG - Intergenic
1100387536 12:94117892-94117914 CAGGCAACAAGCAGTTTTGTAGG - Intergenic
1101314605 12:103617738-103617760 CAGGTAACAGGCATGTTTGTGGG - Intronic
1101808324 12:108084755-108084777 TAGATTAGAGGCAGTATTCTTGG + Intergenic
1102660788 12:114526442-114526464 GAGGGAAGAGGCAGAACTGTTGG - Intergenic
1105390330 13:19971131-19971153 CAGGTAAGGGGAAGAATTGTAGG + Intronic
1106441690 13:29779739-29779761 CAGGTATAAAACAGTATTGTGGG + Intronic
1107827733 13:44344747-44344769 CAGGTATGAGGAAGTTTTCTGGG - Intergenic
1110254607 13:73418736-73418758 AAGGTAAGAGGAAATATTGGAGG + Intergenic
1110929079 13:81193499-81193521 CAGGTAAGAGAGCGTATGGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114318552 14:21527435-21527457 CATGTAAGAGAAAGTATTTTAGG - Intronic
1115332531 14:32213445-32213467 CAGGTATGAGGCAGTGTGGGTGG - Intergenic
1116536149 14:46033517-46033539 GAGGTAAGGTGCAGTATTCTTGG + Intergenic
1118434162 14:65754232-65754254 CAGGTAAGATTCAGAACTGTAGG - Intergenic
1119323627 14:73745867-73745889 CAGGCAAGAGGCCCTATGGTCGG + Intronic
1122879139 14:104682217-104682239 CAGGCAGGAGGCAGCAGTGTGGG + Intergenic
1124868943 15:33521661-33521683 CAGGAAGAAGGCAGTACTGTGGG + Intronic
1129769409 15:78193812-78193834 CAGGGAGGAGGCAGGATGGTGGG + Intronic
1135983423 16:27166395-27166417 GAGATAAGAGGTAGTAATGTGGG + Intergenic
1140317477 16:73913100-73913122 CAGGTAGGAGGCAGAAAGGTAGG - Intergenic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1141476742 16:84279208-84279230 CAGCCAATAGGCAGCATTGTGGG + Intergenic
1143016585 17:3893812-3893834 TAGTTAAGAGGCAGTATGGCAGG - Intronic
1143935251 17:10477118-10477140 AAGATAAGAGGCAGTTATGTTGG + Intergenic
1144777315 17:17791405-17791427 CAGGGAAGAGGCAGAAAGGTGGG - Intronic
1147547082 17:41409998-41410020 CAGGTGAGAGGAAGTTTTATTGG + Intergenic
1147716096 17:42509677-42509699 CATTTAAAAGGCAGTGTTGTTGG - Intronic
1153752242 18:8244767-8244789 CAGGTAGAAGGCATTATTTTAGG + Intronic
1155171791 18:23272125-23272147 GAAGTAAGGGGCAGTCTTGTGGG + Intronic
1155457928 18:26040908-26040930 CATGTAACTGGCAGTGTTGTAGG - Intronic
1156257868 18:35415321-35415343 CAGGTGATAGGAAGTATTGGAGG + Intergenic
1157533163 18:48439305-48439327 AAGGTAAGGGGCAGTCCTGTGGG + Intergenic
1158003536 18:52646477-52646499 GAAGTAACAGGCAGTCTTGTGGG - Intronic
1159192198 18:65061134-65061156 CAGGGAAGAGGCAGTAGTGACGG - Intergenic
1159938905 18:74390474-74390496 CAGGTAAAAGGCAGTAACTTTGG + Intergenic
1160063585 18:75553610-75553632 CAGGTAAGAAACAGTATTCAAGG - Intergenic
1161143378 19:2662428-2662450 GAGGTTAGGGGCAGTCTTGTGGG - Intronic
1161259512 19:3329470-3329492 CAGGTAAGAGTCAATGTTGCAGG + Intergenic
1166934132 19:46320878-46320900 CAGGGAAGAGGCAGAAGCGTGGG - Intronic
1167859497 19:52271255-52271277 GAGGTGAGGGGCAGTCTTGTGGG + Intronic
926560792 2:14415264-14415286 CAGGTATGAGTCAGTGTTTTGGG + Intergenic
927981762 2:27378864-27378886 CAGGTGAGGGGCCGTGTTGTGGG - Exonic
929954676 2:46447172-46447194 GAAGTCAGAGGCAGCATTGTGGG + Intronic
932279811 2:70480865-70480887 CATGGAAGAGGCAGGAATGTTGG - Intronic
932602571 2:73138624-73138646 GAAGTCAGGGGCAGTATTGTGGG - Intronic
932805977 2:74783829-74783851 CAGGGAGGAGGCAGTGTTGAAGG + Intergenic
933394922 2:81718975-81718997 CAGATAAGAGACTGTACTGTGGG + Intergenic
933984021 2:87575718-87575740 CAGGTAAGAGTCTGGACTGTGGG - Intergenic
936309834 2:111375078-111375100 CAGGTAAGAGTCTGGACTGTGGG + Intergenic
936871045 2:117134505-117134527 GTGGTAAGGGGCAATATTGTGGG - Intergenic
937967352 2:127524217-127524239 CAGGTACTAGGCAGTGTTCTGGG - Intronic
939844528 2:147227523-147227545 CAGGCCAGAGGCAGCATGGTAGG + Intergenic
943035366 2:182738369-182738391 AAGGCAAGAGGCTCTATTGTTGG - Intronic
944251908 2:197587155-197587177 GTGGTAAGGGGCAATATTGTGGG - Intronic
944793333 2:203155870-203155892 CAGGTAAAAGGCAAGATTCTAGG - Intronic
945416589 2:209580548-209580570 CAGGAATGACTCAGTATTGTTGG + Intronic
946510925 2:220355423-220355445 CAGGGAAGAGGCAGTTCTGAGGG - Intergenic
948550277 2:238766195-238766217 CAGGAAAGAGGCAGGAGTGCTGG - Intergenic
1170875004 20:20242470-20242492 CTAGTTAGAGGGAGTATTGTGGG + Intronic
1171335682 20:24383407-24383429 CAGTTAAGAGACAGAAGTGTTGG - Intergenic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1173810033 20:45949946-45949968 CAGGTAAGAGTCAGGACTGGGGG - Exonic
1176423343 21:6533194-6533216 CAGGCAAGAGACAGTATGGTGGG - Intergenic
1178396170 21:32245726-32245748 GGGGTAAGTGGCAGTTTTGTGGG + Intergenic
1179698837 21:43141510-43141532 CAGGCAAGAGACAGTATGGTGGG - Intergenic
1181723325 22:24793198-24793220 CAGCTAAGAGGCAGTGATATGGG + Intergenic
1184833559 22:47006882-47006904 GAGGTAGGAGGAAGTATTGCTGG + Intronic
949206158 3:1440824-1440846 CAAGTAGGAGGCACTCTTGTGGG + Intergenic
950051641 3:9995616-9995638 CAGGTAAGAAGCAATATGTTGGG + Intronic
950058882 3:10052495-10052517 CAGGTAAGAGGCAATATGTTGGG + Exonic
950300525 3:11873751-11873773 CAGGTAAGAGGCAATATGTTGGG + Intergenic
950633158 3:14297700-14297722 CAGGTGAGAGGTATTGTTGTCGG - Intergenic
952117992 3:30206066-30206088 GTGGTAAGAGGCAGTATTTCTGG - Intergenic
953724483 3:45386048-45386070 AAGGTTAGAGGCTGTATTTTGGG + Intergenic
953843548 3:46408837-46408859 CAGGAAAAATGCAATATTGTAGG - Exonic
955500737 3:59580200-59580222 CAGGTCAGAGGCACCATTGGGGG - Intergenic
957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG + Intergenic
959780045 3:110220221-110220243 CAAGTAAGAAGCAGTATATTGGG - Intergenic
960417747 3:117406062-117406084 CAGGTAAGAGGAAGGAATTTTGG + Intergenic
960874046 3:122279021-122279043 GATGTAAGTGGCAGTGTTGTGGG + Intronic
962615440 3:137121922-137121944 CAGGTAAGAGCCAGTTGTGGTGG + Intergenic
962683652 3:137825374-137825396 CAGGAAATAGGCAGTGTTCTTGG + Intergenic
963961578 3:151314966-151314988 CAGGCAAGAGGCAGTAGTTTGGG - Intronic
964013394 3:151917642-151917664 CAAGTCAGAGGCAGCCTTGTGGG + Intergenic
965594509 3:170397452-170397474 CAGGTAAGAGCCAGTGTGCTTGG - Intergenic
970801114 4:19974853-19974875 CAGGTACTAGGCATTGTTGTAGG + Intergenic
972830793 4:42811533-42811555 CAGGTAGCAGGCAGATTTGTTGG + Intergenic
973097897 4:46225426-46225448 CAGTTAAGAGCCAGTGTTGGTGG - Intergenic
973321327 4:48813277-48813299 CTTGTAAGAATCAGTATTGTGGG + Intronic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
976906696 4:90245463-90245485 CAGGAAAAAGACATTATTGTTGG + Intronic
977718093 4:100206769-100206791 TAGGTAAGAGGCAGTTATTTGGG + Intergenic
977889768 4:102296090-102296112 CAGGTCAAAGGCAGGCTTGTGGG + Intronic
978824015 4:112999465-112999487 CAGGTGAGAGGCAGAATGGCAGG - Intronic
979513140 4:121576533-121576555 CAGGGAAGTGGCAAAATTGTAGG + Intergenic
980622356 4:135324466-135324488 CAGGTAACAGGCACTTTTCTTGG + Intergenic
984412207 4:179408724-179408746 GTGGTAAGAGGCGATATTGTGGG - Intergenic
986552596 5:8974724-8974746 CAGGCAGGAGGCAGTCTGGTGGG + Intergenic
987619387 5:20320774-20320796 CAGGAAAGAGCCAGTATCCTGGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989429761 5:41339067-41339089 CAGGTATTAGGCAGTATTAGAGG + Intronic
989548732 5:42706694-42706716 CAGGTATGAGGCTTTATTTTGGG + Intronic
990440503 5:55840016-55840038 CAGGTAAGAGACAATGATGTTGG - Intergenic
992109169 5:73476383-73476405 AAGGTGAGAGACAGTATTCTAGG + Intergenic
993404583 5:87495244-87495266 GAGGTAAGAGGCAGCCTTCTTGG + Intergenic
996382857 5:122879510-122879532 GAATTAAGAGGCAGTATTGAAGG + Intronic
997226784 5:132214971-132214993 CAGCTTAGAGGCAGAATTGAAGG - Intronic
1001332012 5:170769081-170769103 CAGGTAAGAGACATCATTGCAGG - Intronic
1002884814 6:1283897-1283919 CAGAAGAGAGGCAGTATTCTGGG + Intergenic
1005582615 6:27248944-27248966 GAGGTAAGAGGCAATGTTGGGGG + Exonic
1009339908 6:62541483-62541505 CAGGCAAGATGCAGTCTGGTCGG - Intergenic
1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG + Intronic
1010385621 6:75276398-75276420 AAAGTGAGAGGCAGTCTTGTGGG + Intronic
1012015771 6:93848789-93848811 CAGGTAAGAGGAAGTTCTGCAGG - Intergenic
1012202033 6:96418650-96418672 GAGTTAAGAGGCAGTAGTCTGGG - Intergenic
1012688404 6:102282486-102282508 CAGTTAAGAGGTAGTATCGGGGG - Intergenic
1014236751 6:118965714-118965736 CAGGGAAGAGCCAGGATTGTAGG - Intronic
1015417846 6:132970045-132970067 CAGGGAGGAGGCAATAATGTAGG - Intergenic
1021618147 7:22523687-22523709 CAGGTGAGAGGCAGGGGTGTGGG + Intronic
1022694562 7:32691650-32691672 CAGGTGAGAGGCAGAGGTGTGGG + Intergenic
1022927744 7:35073162-35073184 CAGGTGAGAGGCAGGGGTGTGGG + Intergenic
1023314604 7:38922434-38922456 CAGAAAAGAGCCATTATTGTAGG - Intronic
1025731917 7:64114974-64114996 CAGGTAGGATGCAGGCTTGTTGG - Intronic
1025777001 7:64568966-64568988 GAGGTGAGAGGCAGTAGGGTTGG + Intergenic
1028457517 7:91054690-91054712 TAGGTGCCAGGCAGTATTGTGGG + Intronic
1029548558 7:101224079-101224101 CAGATAAGACACAGTTTTGTTGG - Exonic
1033533836 7:142293597-142293619 CAGGTGAGAGTCAGTATTTGAGG - Intergenic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1035029472 7:155848172-155848194 CAGGTAGGAGGCAGGTGTGTGGG + Intergenic
1037695161 8:21217182-21217204 CAAGTGGGAGGCAGTTTTGTAGG - Intergenic
1038473053 8:27841706-27841728 CAGCCAAGAGTCAGAATTGTGGG - Intergenic
1039388478 8:37157885-37157907 AAGGTCAGAGGCAGGGTTGTGGG + Intergenic
1040402162 8:47062197-47062219 CAGGTAAATGGCAATATTGCAGG + Intergenic
1041621438 8:59974573-59974595 GAGGTCAGAGGCAGTCTTGATGG + Intergenic
1045533266 8:103003996-103004018 GTGGTAAGGGGCAATATTGTGGG - Intergenic
1045766738 8:105681287-105681309 GAGGTAAGAGACAGCATGGTAGG - Intronic
1046020306 8:108657147-108657169 CAGGTTAGAGGGAGAATTCTTGG + Intronic
1048221554 8:132546800-132546822 CAGGTAAGACCCAGCATTGAAGG + Intergenic
1048529207 8:135232474-135232496 CAGTTAAGAGGCAAGACTGTTGG - Intergenic
1049466827 8:142755221-142755243 CAGAAAAGAGGCAGTGGTGTGGG - Intergenic
1050184991 9:2963825-2963847 CATGTATGAGACAGTATAGTCGG - Intergenic
1051688436 9:19683226-19683248 CAGGCAAGATGCAGTTTAGTGGG + Intronic
1052421636 9:28250515-28250537 CAGGAAAGGGGCAGTTTTGCAGG + Intronic
1055066637 9:72125689-72125711 CAGGTCAATGGCAGAATTGTGGG + Intronic
1056667371 9:88591399-88591421 CAGCTGAGAGGCAGTAATGGAGG + Intergenic
1058099416 9:100902452-100902474 CAGGTAATGGGCTTTATTGTGGG + Intergenic
1059862350 9:118478815-118478837 CAGAAAAGAGGCAGTGTGGTTGG - Intergenic
1060204527 9:121674722-121674744 GAGGCAAGAGGCAGGATTCTGGG + Intronic
1061115751 9:128610537-128610559 CAACTAAAAGGCAGTAGTGTTGG - Intronic
1186885151 X:13905627-13905649 CATGGAAGAGGCAGAATGGTTGG - Intronic
1192713494 X:73616088-73616110 CAGGCAGGAGGCAGTATAGTAGG + Intronic
1199012365 X:142772365-142772387 CATGTATGAGGCACTATTCTAGG - Intergenic
1199377588 X:147132257-147132279 GTGGTAAGAGACAATATTGTGGG + Intergenic
1199456126 X:148031120-148031142 CAGGTAAGAGGAAGTATGAGGGG + Intergenic
1199600175 X:149537002-149537024 CAGGAAGGAGGCAGTATCCTGGG + Intergenic
1199650408 X:149942938-149942960 CAGGAAGGAGGCAGTATCCTGGG - Intergenic
1200813328 Y:7506511-7506533 CAGGTAAGGGGTGATATTGTGGG - Intergenic