ID: 1072559466

View in Genome Browser
Species Human (GRCh38)
Location 10:96557553-96557575
Sequence TCTTAAATGCAAAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072559466_1072559474 17 Left 1072559466 10:96557553-96557575 CCCTGCCCCCTTTGCATTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 221
Right 1072559474 10:96557593-96557615 TAAAATGACCATGGATAATCTGG No data
1072559466_1072559472 8 Left 1072559466 10:96557553-96557575 CCCTGCCCCCTTTGCATTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 221
Right 1072559472 10:96557584-96557606 TGCAGTCCTTAAAATGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072559466 Original CRISPR TCTTAAATGCAAAGGGGGCA GGG (reversed) Intronic
901024941 1:6274172-6274194 TCCTAAGTGCAAAGGGGCGAGGG + Intronic
901142923 1:7046984-7047006 TCCTAACTTCAAAGGGGGCAGGG - Intronic
902127125 1:14224218-14224240 TCATAAAGGCCAAAGGGGCAGGG + Intergenic
904529650 1:31160000-31160022 TCATAAAGGCAAAGGCCGCAGGG + Intergenic
905641076 1:39590394-39590416 CCTGAAATGCAAAGGGTTCAAGG - Intergenic
907951126 1:59185153-59185175 ACTTAAATCCAAAGTTGGCAAGG - Intergenic
907958985 1:59260759-59260781 CCTTAAAGCCAAAGGGGGCAGGG - Intergenic
908091115 1:60686361-60686383 TCCTAGATACAATGGGGGCATGG - Intergenic
908324472 1:63010110-63010132 TCATAAAGGCCAAGGGGTCATGG - Intergenic
908392651 1:63697586-63697608 TCTTAACTGCAAGGGAGGCTAGG + Intergenic
909551398 1:76901313-76901335 TCCCAATTGCAAAGGGAGCATGG + Intronic
910258298 1:85271969-85271991 TCCTACATGCAAAGGGCTCATGG + Intronic
911621436 1:100070181-100070203 TCTTAAGGGCACAGGGGGCATGG + Intronic
912011461 1:104969497-104969519 TCTTAAAATCAAAGGGGAAAGGG - Intergenic
916304366 1:163312515-163312537 TCCTAAATGGAAAAGGAGCAAGG + Intronic
916588689 1:166169236-166169258 TCTTAAATGCAAATGCAGCCAGG - Intergenic
917024389 1:170626117-170626139 TCAAAAATGCAAAGTGGCCAGGG - Intergenic
917259637 1:173153314-173153336 TCTTAGATTCAATGAGGGCAGGG - Intergenic
917411374 1:174763108-174763130 TTTTAAAAGCAAAGGAGGCCAGG - Intronic
917600085 1:176565397-176565419 TCTAAAATGAAATGGGGGCTGGG + Intronic
918866372 1:189905761-189905783 TCCTAGATACAAAGGGGGGATGG + Intergenic
920002565 1:202809932-202809954 TCTTCAATTAAAAGGGGGGATGG + Intergenic
921047126 1:211485444-211485466 TCTTAAGGGCAAAGGAGGGAGGG + Intronic
921608028 1:217178007-217178029 ACTTAGATGCAAAGGAGGCTGGG - Intergenic
921674844 1:217965866-217965888 TCCCACATGCAAAGGGGTCAGGG - Intergenic
922371198 1:224911849-224911871 TTTTAAAGGCAAAGAGGACAAGG - Intronic
923805820 1:237256766-237256788 TCTAAAATGCAAAGTGAGAACGG + Intronic
1063814969 10:9760841-9760863 ACTTGAAGGCAAAGGGGACAGGG + Intergenic
1064612650 10:17119353-17119375 TCTTAAATCCAAAGTAAGCAGGG + Intronic
1065445452 10:25793960-25793982 TTTTAAAGGCAAAGGGAACAAGG + Intergenic
1065555814 10:26914507-26914529 CCTTGAATGCAAAAGTGGCACGG + Intergenic
1065973618 10:30824046-30824068 TCTCAAGTTCAAAGGGGGCTTGG - Intronic
1066023847 10:31331634-31331656 TCTTATATGCATAGAGGGGATGG + Intronic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067523401 10:47024666-47024688 TCTGAAATGGAAAGGGGGTGAGG - Intergenic
1069407689 10:68119705-68119727 TTTAAAATGCAAAGGTGACAGGG - Intronic
1072143240 10:92609532-92609554 TCTTAAAAGAAAATGGGGCTAGG - Intronic
1072293263 10:93985946-93985968 TCTTAGCTGCAAAGGAGGCTGGG + Intergenic
1072559466 10:96557553-96557575 TCTTAAATGCAAAGGGGGCAGGG - Intronic
1074228063 10:111506821-111506843 TCTTAACTCCAAAGGGAGGAGGG + Intergenic
1076414332 10:130274556-130274578 TCTAAAACACAAAGGAGGCATGG - Intergenic
1078558388 11:12349967-12349989 TCCTAAAAGCAAAGGGGCAAAGG + Intronic
1078731869 11:13982354-13982376 ACTTAACTGCAAAGGAGGCTGGG + Intronic
1079275564 11:19033036-19033058 TCTTGCATGCAAAAAGGGCATGG + Intergenic
1082105896 11:48221467-48221489 ACCTAATTTCAAAGGGGGCAGGG + Intergenic
1083191186 11:61053432-61053454 TCTCAAAAGCAAATGGGGCCAGG + Intergenic
1085132345 11:74051548-74051570 TATTAACTGCAAAGGGAGAATGG - Intronic
1085243478 11:75077858-75077880 TCAAAAATTCAAAGGGGGCCAGG + Intergenic
1086211043 11:84319215-84319237 TCTAAAATAAAAAGGGGGGAGGG - Intronic
1086391354 11:86367537-86367559 AATGAACTGCAAAGGGGGCATGG - Intergenic
1088556704 11:111069151-111069173 GCTAATATGCAAAGGGGTCATGG + Intergenic
1088713096 11:112525732-112525754 TCTTAGCTGCAAAGGAGGCTGGG + Intergenic
1090059780 11:123454280-123454302 TCTTAAATTTAAAGGGGAGAGGG - Intergenic
1090138585 11:124227713-124227735 TCTTTAATGCTGAGAGGGCAGGG - Intergenic
1090909115 11:131103106-131103128 TATTAAATCCAAAGAGGACATGG - Intergenic
1091643392 12:2254620-2254642 TGTTAACAGCAAAGGGGACAGGG - Intronic
1095166978 12:38984417-38984439 TCTTAAGAGCAAATGGGGCCAGG - Intergenic
1096624251 12:52883988-52884010 TCTTAAATGCCAATGGGGGCAGG - Intergenic
1097806808 12:63974088-63974110 TTTAAAATGCACAGGAGGCAGGG - Intronic
1098281141 12:68864045-68864067 TCTTAAACCACAAGGGGGCAGGG + Intronic
1100789984 12:98119817-98119839 TCTAAAATGCAGGGGTGGCAGGG - Intergenic
1102006083 12:109590118-109590140 TCGTAAATGCAGGGAGGGCAGGG - Intronic
1102368847 12:112364107-112364129 TCTAAAATGCAAAATGGGCTGGG + Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1106863326 13:33935143-33935165 TTTCAAATGTCAAGGGGGCAGGG + Intronic
1107001179 13:35547333-35547355 GCTTAAATGCAAAGAGGACAAGG - Intronic
1107889294 13:44900249-44900271 GCTTAAGTGCAAAGGAGGCTGGG - Intergenic
1108890513 13:55252552-55252574 ACTTTAAAGCAAAGGGGGCCGGG - Intergenic
1108924181 13:55717842-55717864 TCTTATAGGCCAAGTGGGCAAGG - Intergenic
1112525262 13:100140537-100140559 CCTGAAATGCAAAGTAGGCATGG - Intronic
1112579134 13:100663471-100663493 TTTTAAGTGCAGAAGGGGCAAGG + Intronic
1113479250 13:110608239-110608261 TCTGAAATGTAAAAGGGTCAAGG + Intergenic
1113717334 13:112521137-112521159 TCTCTAATGCCATGGGGGCATGG - Intronic
1114224671 14:20726587-20726609 TTTTAAAGGAAAAGGAGGCATGG + Intergenic
1114699913 14:24666242-24666264 TCTTACATGCAAAGGAGTCTGGG - Intergenic
1114809279 14:25877575-25877597 ACTTAAATGCAAAGTGGATAAGG - Intergenic
1120482365 14:85067148-85067170 TCTTAACTGAAAAAGAGGCATGG - Intergenic
1121144603 14:91573594-91573616 TCTTAGATGAAAAGGGAGGAGGG + Intergenic
1121230636 14:92355111-92355133 TGTTAGATGCAATGGGGCCAGGG + Intronic
1123390565 15:19867137-19867159 CCTCAAATGCAAAAGTGGCACGG - Intergenic
1126447925 15:48770714-48770736 TGTTAAATGTGCAGGGGGCAGGG + Intronic
1128407672 15:67359633-67359655 TCTTCAAAGCAAACGGGGCTTGG + Intronic
1128926597 15:71661920-71661942 TCTTACATGTAAAGTGGGGATGG - Intronic
1132337558 15:101058160-101058182 CCCCAAATACAAAGGGGGCAGGG - Intronic
1135089059 16:19498031-19498053 TCCTAAAGGCACAGGTGGCATGG - Exonic
1135336334 16:21604645-21604667 GCTTAAATGCAAGGTGTGCATGG + Intronic
1141196236 16:81863746-81863768 TGTTATACGCCAAGGGGGCAAGG - Intronic
1142879792 17:2875377-2875399 TTGTAAAGGCAAAGGGGACAGGG + Intronic
1144238781 17:13288799-13288821 TTTTAAAGGCAAAGGGAACAAGG + Intergenic
1144483714 17:15647928-15647950 TCTTAAAACCAAAGGGGGCCGGG + Intronic
1144914972 17:18717080-18717102 TCTTAAAACCAAAGGGGGCTGGG - Intronic
1147280568 17:39356977-39356999 TCTTTAAAGCAAATGGGGCTGGG + Intronic
1149963005 17:61132708-61132730 TGTTAAATGCAGAGGAGGCAAGG + Intronic
1150419151 17:65015365-65015387 TATTAAAAGCAATGGGGGCTGGG + Intronic
1151771262 17:76163574-76163596 TCCTAAAAGTAAATGGGGCAGGG - Intronic
1155045254 18:22097577-22097599 TCTGAAATGAAAGGGGGACAGGG + Intronic
1155267054 18:24104360-24104382 CCTTAAATGCACAGGGCACAGGG + Intronic
1155308394 18:24500964-24500986 TCATAAGTACAAAGGGGGCCAGG - Intergenic
1155455566 18:26008474-26008496 TTTTATATAAAAAGGGGGCATGG + Intergenic
1157097024 18:44695054-44695076 CAATAAAGGCAAAGGGGGCATGG + Intronic
1157466357 18:47949659-47949681 TTTTAAAGGCAAATGGGGGAGGG + Intergenic
1158353675 18:56592327-56592349 CTTTAAAAGCAAAAGGGGCAAGG + Intergenic
1160388154 18:78510380-78510402 ACTTAAAGGCAAAGGGAGGAAGG + Intergenic
1164783233 19:30910146-30910168 TCCTAAATGCAATGAAGGCAAGG + Intergenic
1166744089 19:45131713-45131735 TCTAAAAAACAAAGGGGTCAAGG - Intronic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1168716008 19:58527799-58527821 TCTTAAACACAAAGCAGGCAGGG - Intronic
925879445 2:8340016-8340038 TCTGAAATTCAAATGGGGCTGGG - Intergenic
927429096 2:23011847-23011869 TAATAATAGCAAAGGGGGCATGG + Intergenic
927481123 2:23454924-23454946 TCTTTAATGGAAAGGCGCCACGG - Intronic
928233295 2:29518638-29518660 TCTTACCAGCAAAGGGGTCAGGG - Intronic
928808998 2:35198824-35198846 TCCTAGATGCAATGGGGGTATGG - Intergenic
929485341 2:42348331-42348353 TATTAACTGCAAAGGGGAAAGGG + Intronic
929712856 2:44282165-44282187 TCAGAAAGGCAAAGGGGGCCAGG - Intronic
930295937 2:49553612-49553634 TTTCAAATCAAAAGGGGGCAGGG - Intergenic
933910886 2:86940592-86940614 TCTAAAATGAAAAGAGGGCCAGG - Intronic
934021842 2:87962818-87962840 TCTAAAATGAAAAGAGGGCCAGG + Intergenic
938621602 2:133060589-133060611 ATTTAAATAAAAAGGGGGCAAGG - Intronic
939887919 2:147701343-147701365 TCCCAAATGCAAGGAGGGCAAGG + Intergenic
940723623 2:157309260-157309282 GATTAAATGCAAAGCTGGCAAGG - Intronic
941232645 2:162930640-162930662 TGGTAAAGGCAAAGCGGGCAGGG - Intergenic
941427519 2:165367714-165367736 TCTCACCTGCAAAGGGGTCAGGG - Intronic
942048125 2:172112623-172112645 ACATAAGTGCAAAGGGGGCTAGG - Intergenic
942143165 2:172998416-172998438 TCTTAAATGTAAAGCCGGCTGGG + Intronic
942164154 2:173225296-173225318 TCTTCCATCCAAAAGGGGCAGGG + Intronic
943021699 2:182582150-182582172 CTTTAAATGCAAAGGTGGCAAGG + Intergenic
944923968 2:204443984-204444006 TGCTACATGCAAATGGGGCAAGG - Intergenic
945726389 2:213475947-213475969 ACTTAAATGCAGAGGAGGGAAGG + Intronic
945920565 2:215750883-215750905 CCCCAAATGCAAAGGCGGCAGGG - Intergenic
946710027 2:222496010-222496032 TCTTGAATGTAAAGGAGGAACGG - Intronic
947663334 2:231886505-231886527 ACTTAACTGCAAAGGAGGCTGGG + Intergenic
1168756750 20:324105-324127 TCTTAAAGGCACAGGGTGCTTGG - Intergenic
1168912070 20:1456201-1456223 TCTGAAATGCTGAGGGGTCAAGG + Intronic
1169554757 20:6737402-6737424 TGTTAAATGGAAAGGGGGGCTGG - Intergenic
1171110948 20:22482094-22482116 TCTTACCTGGAAAGGGGACATGG - Intergenic
1171282058 20:23909577-23909599 TCATTAGTGCAAAGGTGGCAAGG + Intergenic
1172187559 20:33040594-33040616 TATTAATGGAAAAGGGGGCATGG - Intronic
1172695466 20:36819794-36819816 TTTGAAATGCAAATGAGGCAGGG + Intronic
1172850855 20:37963010-37963032 TATTAACTGCAAAGGGCACAAGG - Intergenic
1174107511 20:48173093-48173115 ACCTAAATGCAAAGGAGGCTGGG - Intergenic
1174778824 20:53369915-53369937 TCTTTAATGCAAAGATGGTAAGG + Intronic
1178176307 21:30103667-30103689 TCTTCATTGAAAAGGTGGCATGG + Intergenic
1180513702 22:16119213-16119235 CCTCAAATGCAAAAGTGGCATGG - Intergenic
1181235263 22:21444674-21444696 TCATTAGTGCAAATGGGGCAGGG + Intronic
1182241486 22:28919800-28919822 TCTTAAGAGTAAAGGGGGCCAGG - Intronic
1183511904 22:38240696-38240718 TCCTAAATGCAAAGAGGAGAGGG + Intronic
1183554035 22:38511268-38511290 TCTTAATTGAAAAGGGAGAAAGG - Intergenic
949832729 3:8233216-8233238 TCTGAAATACAAAATGGGCATGG - Intergenic
952110227 3:30114379-30114401 TCTCAAATACAAAGGGATCATGG - Intergenic
952684093 3:36130075-36130097 AATTAAATGCAAAGGAGGGAAGG - Intergenic
954452587 3:50579777-50579799 TCTGAAATGCATGGAGGGCATGG - Intronic
955193094 3:56780270-56780292 TCTTAGAGGCAAAGATGGCAGGG - Intronic
960169866 3:114447547-114447569 TCTGAAATGCAAACAGTGCAGGG - Intronic
961669782 3:128520624-128520646 TCTGAAGTGCAAAGGAGGCTGGG - Intergenic
962176064 3:133156736-133156758 ACCTAACTGCAAAGGAGGCAAGG - Intronic
962626098 3:137227387-137227409 TCTTGAATGGAACTGGGGCAAGG + Intergenic
966051231 3:175619488-175619510 ACTTAAATGCAGAGGAGGGAAGG + Intronic
968839926 4:2995780-2995802 TTTTAAAGGCAAAGGGAACAAGG + Intronic
968889537 4:3360849-3360871 GCTCAAATGCACAGTGGGCAAGG + Intronic
971246105 4:24929437-24929459 TTTGAAGTGGAAAGGGGGCAGGG + Intronic
971777949 4:30992544-30992566 TCTGAAAGGCAAAGGGGACATGG - Intronic
973324214 4:48841364-48841386 TCATAAAAGGAAAGGGAGCATGG + Intronic
975654512 4:76628334-76628356 CCTTAAATTCAAAGAGAGCAAGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976723165 4:88190041-88190063 TCATAAATGCAAAGAAGGCATGG + Intronic
977340499 4:95751447-95751469 TATAAAATGGAAAGGGGGAAAGG - Intergenic
978068169 4:104432125-104432147 ACTTAGAGGCAAAGGGGGAAGGG - Intergenic
978250068 4:106619921-106619943 ACCTAAATGCAAAGGGAGCTAGG + Intergenic
980881223 4:138711859-138711881 CCTTAAAGACAAAGGGAGCATGG - Intergenic
981482070 4:145249306-145249328 TCTTCACTGCAAAGGAGGCTGGG - Intergenic
982481549 4:155917851-155917873 CCATAAAGGCAAAGGTGGCATGG + Intronic
983121367 4:163889454-163889476 TTTTAAATGCAATGAGAGCAGGG + Intronic
987120441 5:14762058-14762080 TTTTAAAGGCAAAAGGGGCTGGG - Intronic
989260821 5:39418052-39418074 TTTTAGAGGTAAAGGGGGCAGGG + Intronic
990052414 5:51521307-51521329 TCATAAATCCAAAGGGAGAATGG + Intergenic
990337274 5:54787029-54787051 ACTTAAATGCAAAGGAAGCCAGG + Intergenic
992066059 5:73110295-73110317 TCTCAAGTGCACATGGGGCATGG - Intergenic
993997889 5:94744357-94744379 TCTAAAATGCACAGGGAGCAAGG + Intronic
994123724 5:96146982-96147004 TCTTAAGTGCAAAGGAAGCTGGG + Intergenic
995796535 5:115947050-115947072 TCTTAACTGCAAAGGAGACTGGG - Intergenic
996409426 5:123141936-123141958 ATTTAAATGAAAAGGAGGCATGG - Intronic
997503209 5:134395153-134395175 CCTTAAGAGCAAAGGGGGCTGGG + Intergenic
997509672 5:134445411-134445433 TGATAACTGCAAAGGGGGCTAGG + Intergenic
997691671 5:135831583-135831605 TCTTAAAGAAGAAGGGGGCAGGG + Intergenic
999811034 5:155127198-155127220 TCTTAAAGGAAAAGATGGCAGGG + Intergenic
1003447298 6:6196341-6196363 TCCTAAATGCATGGTGGGCATGG - Intronic
1003679858 6:8242219-8242241 TTGTAAAAGCACAGGGGGCAAGG - Intergenic
1005164489 6:22903679-22903701 TTTTAAATGGAAAGAGGGCTGGG + Intergenic
1005627622 6:27678460-27678482 TCATAAATGTAAAGGTGGCAAGG + Intergenic
1006866946 6:37216372-37216394 TCTAAAATGCAAATCGGGCCAGG - Intronic
1008088440 6:47268521-47268543 TCTTCAAGGCAAAGGTGGGAAGG + Intronic
1012034312 6:94111885-94111907 ACTAAAATGCAAAGGGCACAAGG - Intergenic
1012593601 6:101014197-101014219 ACTGAAATGGATAGGGGGCAAGG + Intergenic
1015078760 6:129196988-129197010 TCTAAACTCCAAAGGGAGCAGGG - Intronic
1015245529 6:131070342-131070364 ACTTAAATGCAAAGGATGCTGGG - Intergenic
1016426601 6:143942081-143942103 TCCTAAAGGGAAAGGAGGCAAGG + Exonic
1017909452 6:158780577-158780599 CCTTAAAGGGAAAGGGTGCACGG - Intronic
1021701094 7:23320205-23320227 TATAAAATGCAAAGGGGGCTGGG - Intronic
1024189618 7:46992920-46992942 TCTAACATGTAAAGGGGGAATGG + Intergenic
1024805916 7:53139581-53139603 TCTTAAAGGCAAAAAGGACAAGG - Intergenic
1026060318 7:67019746-67019768 TTTTAAAAGCAAAGGGAACAAGG + Intronic
1027346306 7:77263190-77263212 GCTCAACTGCAAAGGGTGCAAGG - Intronic
1027941446 7:84686194-84686216 TCTTAAAAAGAAAGGGGGAAAGG - Intergenic
1027954967 7:84865929-84865951 TTTTTAATTCAAAGGGGGCAAGG - Intergenic
1028799742 7:94949056-94949078 TCTTAAATACCAAGGGAGAATGG + Intronic
1029125249 7:98291027-98291049 TATTGAATGCAAGGGTGGCAGGG + Intronic
1029251556 7:99240365-99240387 TCTTAAATGGAAAAGTGGCCGGG - Intergenic
1029381425 7:100217631-100217653 TATTCAAGGCAAAGGGGGCAGGG + Intronic
1029400854 7:100344941-100344963 TATACAAGGCAAAGGGGGCAGGG + Intronic
1030377528 7:108770852-108770874 TCTAAAATGCAATGAGGCCATGG - Intergenic
1032000561 7:128262517-128262539 ACCCAAATGCAAAGGGGACATGG - Intergenic
1035035174 7:155890062-155890084 TCTTACCTCCAAAGAGGGCAGGG - Intergenic
1036618043 8:10403942-10403964 TCTTAAATGCTCATGGGTCACGG - Intronic
1036938674 8:13030696-13030718 CCCTAAATGCAAAGGGCGTATGG - Intronic
1042362261 8:67896086-67896108 CCTTAAATGTAAATGGGGCCGGG + Intergenic
1043864244 8:85357645-85357667 TCCTAAAGGGAAAAGGGGCAAGG + Intronic
1044305729 8:90638491-90638513 TCTCCAGTGCAAAGGGGACAGGG - Intronic
1046591612 8:116213980-116214002 TATCAAATGAAAAGGGGGAAAGG + Intergenic
1047186517 8:122638104-122638126 TCTTTAATGCAAAGAGATCATGG + Intergenic
1048851802 8:138652448-138652470 TCTGATCTGCAAATGGGGCAAGG - Intronic
1051166170 9:14264468-14264490 TCTTAAATGCACAGAGAGTAGGG - Intronic
1051405009 9:16727582-16727604 TCTTAAAAGAAAAAGGGGAAAGG - Intronic
1051610249 9:18954651-18954673 TTTTAAATTGAAAGGGGGCATGG + Intronic
1052545944 9:29879787-29879809 TCATAAATTCCAAGGTGGCAGGG + Intergenic
1053708535 9:40781443-40781465 CCTCAAATGCAAAAGTGGCATGG + Intergenic
1054418446 9:64902238-64902260 CCTCAAATGCAAAAGTGGCATGG + Intergenic
1054922934 9:70559935-70559957 TTTAAAATACACAGGGGGCAGGG - Intronic
1055570108 9:77608032-77608054 TCTTGAATGCAAAGGTGGTGGGG + Intronic
1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG + Intronic
1058052876 9:100424252-100424274 TCTTAAAAACTAATGGGGCAGGG - Intergenic
1058226229 9:102367998-102368020 TGTTTAATGGAAAGAGGGCAAGG + Intergenic
1058838458 9:108881017-108881039 TCTTAAAAGCAAAGTGGAGAAGG - Intronic
1185535218 X:855728-855750 TCCAAAATGCAAAAGGGTCATGG - Intergenic
1186285033 X:8033999-8034021 ACTGAAATGGAAAGGAGGCAGGG - Intergenic
1187447199 X:19370364-19370386 TATTAAATTAAAAGGGAGCATGG - Intronic
1191602740 X:63027282-63027304 TCATAAATACAATGGGGGAAAGG - Intergenic
1192829306 X:74734208-74734230 TCTTAAATGCTTAAGGGGCTTGG + Exonic
1196928809 X:120660786-120660808 TCTGAAATGCAAACAGGGCGGGG + Intergenic
1199143394 X:144336352-144336374 TCTGATATGGAAAGGGGGCAAGG - Intergenic