ID: 1072562238

View in Genome Browser
Species Human (GRCh38)
Location 10:96586914-96586936
Sequence CCGTGGATGCGAATCGGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072562238_1072562245 -4 Left 1072562238 10:96586914-96586936 CCGCGGCCGATTCGCATCCACGG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1072562245 10:96586933-96586955 ACGGGGCGCGGACAGACGCACGG 0: 1
1: 0
2: 0
3: 2
4: 59
1072562238_1072562247 -2 Left 1072562238 10:96586914-96586936 CCGCGGCCGATTCGCATCCACGG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1072562247 10:96586935-96586957 GGGGCGCGGACAGACGCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1072562238_1072562246 -3 Left 1072562238 10:96586914-96586936 CCGCGGCCGATTCGCATCCACGG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1072562246 10:96586934-96586956 CGGGGCGCGGACAGACGCACGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1072562238_1072562248 3 Left 1072562238 10:96586914-96586936 CCGCGGCCGATTCGCATCCACGG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1072562248 10:96586940-96586962 GCGGACAGACGCACGGGGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072562238 Original CRISPR CCGTGGATGCGAATCGGCCG CGG (reversed) Exonic
900576507 1:3385183-3385205 GCGTGGATGCAAATCAGGCGGGG + Exonic
901836237 1:11925914-11925936 ACGTGGCTGCCAATCGGCTGTGG - Exonic
907245117 1:53103486-53103508 CCGTAGATGAGGATCCGCCGAGG + Exonic
1070988945 10:80714702-80714724 CGGGGGATGCGACTCCGCCGGGG + Intergenic
1072562238 10:96586914-96586936 CCGTGGATGCGAATCGGCCGCGG - Exonic
1076551016 10:131278189-131278211 GAGAGGATGCGACTCGGCCGGGG - Intronic
1077361727 11:2143852-2143874 CCGTGGATTGGAATCCCCCGAGG + Intronic
1078098157 11:8313049-8313071 CCGTGGATGCAGATGGGGCGGGG - Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1134531871 16:14989837-14989859 ACGTGGCTGCCAATCGGCTGTGG - Intronic
1160765449 19:805623-805645 CCGTGGATGCGGAGCTGCCTGGG - Intronic
1169651369 20:7871244-7871266 GCGTGGATGCGATTGGGCCCAGG - Intergenic
969363075 4:6677468-6677490 CCGTGGATGGAAATGGGGCGGGG + Intergenic
978954728 4:114599312-114599334 ACGGGGAGGCGATTCGGCCGAGG + Intronic