ID: 1072562438

View in Genome Browser
Species Human (GRCh38)
Location 10:96588108-96588130
Sequence CACGAGGGCGTTCATCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072562432_1072562438 27 Left 1072562432 10:96588058-96588080 CCTTGCTTAAAACAGTTCTTCAA No data
Right 1072562438 10:96588108-96588130 CACGAGGGCGTTCATCTGCCAGG No data
1072562431_1072562438 28 Left 1072562431 10:96588057-96588079 CCCTTGCTTAAAACAGTTCTTCA No data
Right 1072562438 10:96588108-96588130 CACGAGGGCGTTCATCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072562438 Original CRISPR CACGAGGGCGTTCATCTGCC AGG Intergenic
No off target data available for this crispr