ID: 1072563454

View in Genome Browser
Species Human (GRCh38)
Location 10:96598001-96598023
Sequence TTGCAGACCTATAATTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072563452_1072563454 22 Left 1072563452 10:96597956-96597978 CCAGCTAAAGATTGGAAGCTACA 0: 1
1: 0
2: 1
3: 7
4: 68
Right 1072563454 10:96598001-96598023 TTGCAGACCTATAATTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072563454 Original CRISPR TTGCAGACCTATAATTATAG TGG Intronic
No off target data available for this crispr