ID: 1072564976

View in Genome Browser
Species Human (GRCh38)
Location 10:96609939-96609961
Sequence CTGTGAGAGAGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 1, 2: 7, 3: 69, 4: 795}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072564976_1072564987 0 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564987 10:96609962-96609984 GAGCCTGCATGGGAAGGGGAAGG 0: 1
1: 0
2: 5
3: 56
4: 588
1072564976_1072564994 20 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564994 10:96609982-96610004 AGGGGAAGGGAAAAGACGATGGG 0: 1
1: 0
2: 3
3: 59
4: 577
1072564976_1072564997 29 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564997 10:96609991-96610013 GAAAAGACGATGGGAGAGGGAGG 0: 1
1: 0
2: 5
3: 39
4: 596
1072564976_1072564996 26 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564996 10:96609988-96610010 AGGGAAAAGACGATGGGAGAGGG 0: 1
1: 0
2: 7
3: 54
4: 574
1072564976_1072564989 2 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564989 10:96609964-96609986 GCCTGCATGGGAAGGGGAAGGGG 0: 1
1: 0
2: 6
3: 58
4: 590
1072564976_1072564998 30 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564998 10:96609992-96610014 AAAAGACGATGGGAGAGGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 659
1072564976_1072564991 6 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564991 10:96609968-96609990 GCATGGGAAGGGGAAGGGGAAGG 0: 1
1: 7
2: 372
3: 1230
4: 4303
1072564976_1072564993 19 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564993 10:96609981-96610003 AAGGGGAAGGGAAAAGACGATGG 0: 1
1: 0
2: 18
3: 146
4: 1288
1072564976_1072564995 25 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564995 10:96609987-96610009 AAGGGAAAAGACGATGGGAGAGG 0: 1
1: 0
2: 3
3: 49
4: 628
1072564976_1072564986 -4 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564986 10:96609958-96609980 ACAGGAGCCTGCATGGGAAGGGG 0: 1
1: 0
2: 2
3: 32
4: 351
1072564976_1072564985 -5 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564985 10:96609957-96609979 CACAGGAGCCTGCATGGGAAGGG 0: 1
1: 0
2: 2
3: 30
4: 383
1072564976_1072564983 -10 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564983 10:96609952-96609974 TCTCTCACAGGAGCCTGCATGGG 0: 1
1: 0
2: 1
3: 15
4: 172
1072564976_1072564992 7 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564992 10:96609969-96609991 CATGGGAAGGGGAAGGGGAAGGG 0: 1
1: 9
2: 388
3: 918
4: 3449
1072564976_1072564988 1 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564988 10:96609963-96609985 AGCCTGCATGGGAAGGGGAAGGG 0: 1
1: 0
2: 3
3: 42
4: 455
1072564976_1072564984 -6 Left 1072564976 10:96609939-96609961 CCCTCCACCTGCCTCTCTCACAG 0: 1
1: 1
2: 7
3: 69
4: 795
Right 1072564984 10:96609956-96609978 TCACAGGAGCCTGCATGGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072564976 Original CRISPR CTGTGAGAGAGGCAGGTGGA GGG (reversed) Intronic
900151562 1:1181204-1181226 CTGTGAGATGGACAGGTGGGTGG - Intronic
900178158 1:1299722-1299744 GTGGGAGACAGGCAGGAGGAAGG + Intronic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900631640 1:3639562-3639584 CAGTGGGAAATGCAGGTGGAGGG - Intronic
900711878 1:4119590-4119612 CAGGGAGACAGGCAGGAGGAGGG + Intergenic
901084142 1:6600602-6600624 CTGTGTGAAAGGCAGCTGAAAGG + Intronic
901100416 1:6715267-6715289 CTGGGAGGGAGGGAGGTGGGGGG - Intergenic
901434639 1:9239695-9239717 CTGTGCGCCAGGCAGGAGGAAGG - Intronic
901547735 1:9971717-9971739 CTTTGAGAGACTGAGGTGGAAGG + Intronic
901653067 1:10754190-10754212 GGGAGTGAGAGGCAGGTGGATGG - Intronic
901742307 1:11350307-11350329 CTATCAGTGAGGCAGGAGGAGGG - Intergenic
902264439 1:15251918-15251940 CTGTTAGAGAGGGAGAAGGAAGG - Intronic
902718282 1:18287825-18287847 CAGAGAGGGAGGCAGGTGGAAGG - Intronic
902872561 1:19323294-19323316 GGCTGAGGGAGGCAGGTGGAAGG + Intronic
903099494 1:21016440-21016462 CTTTGAGAGGTGGAGGTGGAAGG + Intronic
903758910 1:25684191-25684213 GGGGGAGAGAGGCAGGTGGCTGG - Intronic
904283187 1:29435722-29435744 CTTTGAGAGACCAAGGTGGATGG - Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904462336 1:30687525-30687547 AGGTGAGAGAGGCAGGTGGCTGG - Intergenic
904766337 1:32851420-32851442 CTTTGAGAGAGCAAGGTGGGTGG + Intronic
905084954 1:35364957-35364979 CAGTAATAGAGGCAGGAGGACGG - Intronic
905206251 1:36344342-36344364 AAGTGAGGGTGGCAGGTGGAGGG - Intronic
905226357 1:36481725-36481747 CTGTGAGGGAGGCAGGGGTGAGG - Intronic
905322450 1:37127677-37127699 CTATGAGAGAGGCAGCTACAAGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905733277 1:40310786-40310808 CTGTCAGACAGGCAGGCAGATGG + Intronic
906760703 1:48374879-48374901 CTCTGAAAGAGGCAGGTTAATGG - Intronic
907282911 1:53362611-53362633 CTGTGAGGGAGGCAGTGGGAGGG - Intergenic
907554777 1:55334386-55334408 CTGGGAGGGAGGTAGCTGGAGGG + Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908398973 1:63752439-63752461 GTGTGAGACAAGCATGTGGAGGG + Intergenic
909236528 1:73159646-73159668 CAGTGAGAGAGTTAGGTGCAAGG - Intergenic
909498861 1:76310863-76310885 CTGTCAAGGAGTCAGGTGGAAGG - Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910836984 1:91524093-91524115 CTGTGAGAGACTCAGGGGTATGG + Exonic
911308763 1:96266482-96266504 ATGGGAGGGTGGCAGGTGGAAGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912266146 1:108160100-108160122 CTGTCCGGGAGGGAGGTGGAGGG - Intronic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
914457387 1:147848619-147848641 CTATGACAGATGCAGGGGGAGGG + Intergenic
914775190 1:150728987-150729009 CTGTCCGGGAGGCAGGTGGGGGG - Intergenic
915656768 1:157367093-157367115 ATGTGAGAGAGGCAGGTGGCAGG - Intergenic
915672191 1:157499142-157499164 ATGTGAGACAGCCAGGTGGGAGG + Intergenic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916555451 1:165890737-165890759 CTGGCAGAGAGGGAGATGGAGGG + Intronic
916696500 1:167242940-167242962 GGGGGAGAGAGGCAGGTGGAAGG - Intronic
917784678 1:178441593-178441615 TTCTGAGAGAGACAAGTGGATGG + Exonic
918345540 1:183604322-183604344 ATGTCAGAGAGGCAGGAGGAAGG + Intergenic
918420631 1:184361127-184361149 TTCTGAGAGTGGAAGGTGGAAGG - Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918945099 1:191053620-191053642 CAGAGAGAGAGAGAGGTGGAAGG + Intergenic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
921271666 1:213475606-213475628 CTGAGGGAGAGGCAGCGGGAGGG - Intergenic
922013692 1:221620873-221620895 CTGGAAGAGGGCCAGGTGGATGG - Intergenic
922095906 1:222442615-222442637 CTGGGAGAGAGTCAGAAGGATGG + Intergenic
922897461 1:229111500-229111522 CTCTGAGAGAGGCAGGTCTGGGG + Intergenic
923026453 1:230208398-230208420 CTGTGAGTGGAGCAGGTGTAGGG + Intronic
923268368 1:232333655-232333677 CTGTGCGTGAGGCAGGTTCAGGG - Intergenic
923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG + Intergenic
923800904 1:237207320-237207342 CTTTGAGAGGTGGAGGTGGATGG + Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1063120310 10:3101306-3101328 CTGAGAGAGCGCCAGGTGGATGG - Intronic
1063367379 10:5499487-5499509 CTCTGAGAGCAGCAGGTTGAGGG - Exonic
1064061059 10:12137546-12137568 CTGTGGGAGATACAGGTAGATGG - Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1064668280 10:17680648-17680670 CTTTGGGAGATGAAGGTGGAAGG - Intronic
1065354644 10:24827962-24827984 CTTTGGGAGACGGAGGTGGATGG - Intergenic
1066423773 10:35286053-35286075 CTTTGAGAGACTGAGGTGGACGG - Intronic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1068080563 10:52313786-52313808 CTCTGAGAGGGCCAGGTGGCGGG - Intergenic
1069133026 10:64729793-64729815 ATGTGAGAGAGGCAGCAGAAAGG + Intergenic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1069498528 10:68929188-68929210 CTGTGGGAGACGGAGGTGGGTGG - Intronic
1069652099 10:70056671-70056693 AAGGGAGCGAGGCAGGTGGAAGG + Intronic
1071033681 10:81216344-81216366 CTGTGACATACGCAGGAGGAAGG - Intergenic
1071044804 10:81361073-81361095 TTGTGAGAAAGCCAGGTGGCAGG + Intergenic
1072116759 10:92375540-92375562 CTGTCCGGGAGGGAGGTGGAGGG + Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074659453 10:115636308-115636330 CTGTGAGATAGGGATGTGGTGGG - Intronic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075136978 10:119794800-119794822 CTGGGAGGGAGGGAGGTGGGGGG - Intronic
1075241184 10:120780549-120780571 CAGTGGGAGAGGCAGTCGGAGGG - Intergenic
1075343762 10:121667383-121667405 TTGTTAGACAGGCAGGTGAATGG + Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076568081 10:131412370-131412392 CTGGGACAGAGGCAGGGGCAGGG + Intergenic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1077308793 11:1879491-1879513 CTGTGAGCGGGGCTGGTGGTGGG + Intronic
1077487407 11:2845467-2845489 GTGTGAGAGACCCCGGTGGATGG + Intronic
1077504376 11:2923301-2923323 CTCCCAGACAGGCAGGTGGATGG - Intronic
1077504386 11:2923362-2923384 CTCCCAGACAGGCAGGTGGATGG - Intronic
1077504396 11:2923423-2923445 CTCCCAGACAGGCAGGTGGATGG - Intronic
1077504406 11:2923484-2923506 CTCCCAGACAGGCAGGTGGATGG - Intronic
1077971562 11:7197727-7197749 CTGTTGGAGAAGCAGCTGGAAGG - Intergenic
1079424884 11:20330650-20330672 TAGAGGGAGAGGCAGGTGGAAGG - Intergenic
1079886248 11:25993125-25993147 GGGTGAGAGTGGGAGGTGGATGG - Intergenic
1080660706 11:34293679-34293701 CTGTGAGAGAGACTGGGGTAAGG + Intronic
1080762576 11:35266301-35266323 GTGTGAGGGAAGCAGGTGCAGGG - Intronic
1080839736 11:35972805-35972827 CTTTGGGAGACCCAGGTGGATGG + Intronic
1080908089 11:36566911-36566933 CTGTCAAGGAGGCAGGTGCAAGG - Intronic
1081048376 11:38305821-38305843 CTGTGAGAGATTCATGTGGGAGG + Intergenic
1081106369 11:39075037-39075059 ATGTGAGAGAGAGAGGGGGAGGG - Intergenic
1081262339 11:40976176-40976198 CTGTGAGAAAGCCAAGTGCAAGG - Intronic
1082800788 11:57413547-57413569 GTGTGGGAGAAGCAGGTGCATGG + Intronic
1083178164 11:60965939-60965961 CTGGGGTAGAGGCATGTGGATGG + Intergenic
1083372332 11:62192321-62192343 CTGTGAGGGACACAGGTGGTGGG + Intronic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084040765 11:66541458-66541480 TTGTGAGACAAGCAGGTGGACGG + Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084536549 11:69760798-69760820 CTGTGAGTGTGTCAGGGGGAGGG + Intergenic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085686047 11:78622822-78622844 CTGGGGGAGAGGTATGTGGATGG + Intergenic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1085825835 11:79846346-79846368 ATGAGAGAGAAGAAGGTGGAGGG + Intergenic
1086943885 11:92825932-92825954 ATGTGAGAGAGGAAGTTAGAAGG + Intronic
1087486665 11:98765284-98765306 CATTGAGAGAGCCAGGTGGGAGG + Intergenic
1087686854 11:101274737-101274759 CTGTGAATGAGCCTGGTGGAGGG + Intergenic
1088326758 11:108608843-108608865 CTGTGTGAGAGAGAGGGGGAGGG + Intergenic
1088417108 11:109601227-109601249 ATGTGAGAAGGGCAGATGGATGG + Intergenic
1088536345 11:110866345-110866367 ATGTGAGTGAGGCAGGAGGAAGG - Intergenic
1088862656 11:113816550-113816572 ATGTGAGAGAGTGAGGAGGAGGG - Intronic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089190829 11:116651969-116651991 ATGTCAGGGAGGCAGGTGGCTGG + Intergenic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089759301 11:120711385-120711407 CTGTGGCAGAGGCAGGTGATGGG - Intronic
1090003161 11:122979253-122979275 CTGTCCGAGACGCAGGTGGGCGG - Exonic
1090244602 11:125206966-125206988 CTGTGAGAGAGGGAGGGGCTGGG + Intronic
1090477541 11:127037212-127037234 CTGTGACACAGGCAGGAGGCTGG - Intergenic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1091115192 11:133006111-133006133 TTGTGAGACAGCCAGGTGGGAGG + Intronic
1091738216 12:2940827-2940849 CTGTGAGGGAGGCACTTGGTGGG - Exonic
1091777831 12:3196139-3196161 TGGTGAGAGAGGGAGGAGGAGGG + Intronic
1091949407 12:4580537-4580559 CTGGGAGGGAGGGAGGTGGCTGG - Intronic
1092746501 12:11677274-11677296 CAGAGAGAGAGGCAGGAGGAGGG - Intronic
1092839739 12:12528310-12528332 CTGGGAGAGGGGCCGGTGTATGG + Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1093881928 12:24414588-24414610 CTGGGTGAGAGGCAGGCAGATGG - Intergenic
1093943715 12:25084142-25084164 CTTTGAGAGATCGAGGTGGAAGG + Intronic
1094008730 12:25784160-25784182 TGGTGAGAGAGGCAGCAGGATGG - Intergenic
1094015114 12:25854662-25854684 CTCTGGGACAGGGAGGTGGATGG - Intergenic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094059026 12:26293811-26293833 CTGAGAAAGAGGCATGTGAATGG + Intronic
1094390125 12:29939953-29939975 CAGTGAGACAGCCAGGTGGGAGG - Intergenic
1095153651 12:38825697-38825719 CTGTGAGAGAGGCATATGTCTGG - Intronic
1096245506 12:49983086-49983108 ATGTGAGATAGGCTGTTGGATGG - Intronic
1096260218 12:50085545-50085567 CGGTGAGTGGGGCAGGAGGAGGG + Exonic
1096749850 12:53751762-53751784 CACTGAAAAAGGCAGGTGGATGG - Intergenic
1096801437 12:54113077-54113099 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1099148933 12:79083989-79084011 CAAGGAGAGAGGCAGGTTGAGGG + Intronic
1099503915 12:83448575-83448597 GTGGGAGATAGGCAGGGGGATGG + Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099978358 12:89570199-89570221 CTGTCAGCGGGGCAGGGGGAGGG - Intergenic
1100923479 12:99516583-99516605 CTGTCAGGGAGGCAGGGGGAGGG + Intronic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1102025264 12:109711046-109711068 AGGTGAGAGAGGCACGTGCAAGG + Intergenic
1102072321 12:110031017-110031039 CTGGGGGAGAGGCGGGGGGATGG + Intronic
1102124189 12:110467231-110467253 CTTTGGGAGATGGAGGTGGACGG - Intronic
1102402837 12:112645566-112645588 CTTTTAGAGAGGCAGGTGTAGGG + Intronic
1102813723 12:115845347-115845369 CTGGGAGAATGCCAGGTGGAAGG - Intergenic
1103524350 12:121557912-121557934 CTGGGAGGGAGGCAAGGGGAGGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103649951 12:122424086-122424108 CTTTGAGAGACCCAGGTGGGTGG + Intergenic
1103862773 12:124027586-124027608 GAGTGACAGAGACAGGTGGATGG - Intronic
1104209963 12:126679224-126679246 CTGGGAAAGAGGCACATGGATGG - Intergenic
1104467991 12:129005610-129005632 CTGAGAGAGAAGCAGTTGGAGGG + Intergenic
1104564937 12:129872092-129872114 CTGTGATTGAGGTTGGTGGAAGG - Intronic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104717470 12:131025776-131025798 CTTTGGGAGACGGAGGTGGATGG - Intronic
1104975322 12:132549574-132549596 CTCTGAGAGAGGCAGGAAGGAGG + Intronic
1105211681 13:18260880-18260902 CCTTGAGAGAGGCATGGGGAAGG - Intergenic
1105538616 13:21293843-21293865 CTGGGAGAGTGGCAGGGGGTGGG - Intergenic
1105859231 13:24394854-24394876 CTGAGAGACAGGGAGGAGGAGGG - Intergenic
1105871971 13:24513023-24513045 CTTTGAGAGAGGTGGGTGGATGG + Intergenic
1105901787 13:24761609-24761631 CTGGTAGAGAGGCAGGCAGAGGG + Intergenic
1105917639 13:24931859-24931881 CTTTGGGAGAGGTGGGTGGATGG - Intergenic
1106006439 13:25774403-25774425 CTGTTGGGGAGGCAGGGGGAGGG + Intronic
1106578724 13:30999771-30999793 ACCCGAGAGAGGCAGGTGGAAGG + Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107278532 13:38705843-38705865 CTGTGAGAAAGACAGGAGAAAGG - Intronic
1107448329 13:40487346-40487368 CTGGGAGAAAGACAGGTGGCTGG + Intergenic
1107890500 13:44910268-44910290 TAATGAGAGAGTCAGGTGGAAGG + Intergenic
1108164208 13:47675278-47675300 CTGTGTGGGAGACAGGTGAATGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109012482 13:56969842-56969864 CAGTGAGACAGACAGGTGGGAGG + Intergenic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1109744884 13:66612626-66612648 CTGTGAGACAGCCAGGTTGGAGG + Intronic
1112187348 13:97140028-97140050 CTGTAAGGGAGGCAAGAGGATGG - Intergenic
1112419862 13:99238487-99238509 CTGGCAGTGAGGCAGGAGGAGGG - Exonic
1112487288 13:99831397-99831419 CTCTCAGGGAGGCAGGTGGAGGG + Intronic
1112917755 13:104572206-104572228 GTGTGTGAGAGGCAGGTGCTGGG - Intergenic
1113858045 13:113460213-113460235 CAGAGAGTGTGGCAGGTGGAGGG - Intronic
1114218278 14:20673998-20674020 TTGTGAGACAGCCAGGTGGAAGG - Intergenic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114561002 14:23590407-23590429 CTTTGGGAGATGAAGGTGGAAGG + Intergenic
1114682935 14:24502139-24502161 GTGTGTGAGAAGCAGGTTGATGG - Intronic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1114927393 14:27421370-27421392 CGGTGAGAGAGGCAGCAAGAGGG + Intergenic
1115511943 14:34146496-34146518 CTCAGGGAGAGGCAGCTGGAGGG + Intronic
1116610765 14:47068938-47068960 CTGTGAGAGAGGTTGGCAGAAGG - Intronic
1116868721 14:50052004-50052026 CAGAGAGTGGGGCAGGTGGAAGG + Intergenic
1117472992 14:56065360-56065382 CTGTCAGCGGGGCAGGGGGAAGG + Intergenic
1117881178 14:60315051-60315073 CTGTGAGTGTGGCAGGTGCTCGG + Intergenic
1118332790 14:64826769-64826791 CTGCTAGACGGGCAGGTGGATGG - Intronic
1118632416 14:67717818-67717840 CTTTGAGAGACCAAGGTGGAAGG + Intronic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1119125678 14:72123863-72123885 CTGTGATACAGTCAAGTGGAGGG - Intronic
1119182419 14:72613970-72613992 CTGAGAGTGGGGCAGGGGGAAGG - Intergenic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1119273659 14:73332503-73332525 CTTTGGGAGACCCAGGTGGATGG - Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119610725 14:76059634-76059656 CAGTGAGAGAGGGAGTGGGATGG - Intronic
1119716582 14:76863917-76863939 ATTTGAGAGAGGCAGGTGGTGGG - Intronic
1120321580 14:82968618-82968640 CTTTGAGAGACCCAGGTGGGTGG + Intergenic
1120759201 14:88270934-88270956 CTGTGAGATAGGCAGGCGCCAGG - Intronic
1121117561 14:91354388-91354410 CTGTGAGGGAGGATGCTGGATGG - Intronic
1121170882 14:91853306-91853328 AGGTGAGAGAGGAAGGTGGCTGG + Intronic
1121710253 14:96032289-96032311 CTGTGATGGAGCCAGGTGGGTGG + Intergenic
1121880834 14:97499070-97499092 CTGTGAGTGATCCAGGTGCAGGG + Intergenic
1121894798 14:97636938-97636960 CCTTGAGAGATGGAGGTGGACGG - Intergenic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1122344418 14:101049744-101049766 CTGGAAGTGAGGCTGGTGGAGGG + Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122811666 14:104292305-104292327 AGCTGAGAGAGGAAGGTGGAGGG + Intergenic
1122837449 14:104437100-104437122 CTCTCAGAGAGGGAGGTGGCTGG + Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123552832 15:21399068-21399090 CTGTGAGCGAGGTTGGTGGCTGG - Intergenic
1123553048 15:21400348-21400370 CTGTGAGTGAGGTTGGTGGCTGG - Intergenic
1123589078 15:21836456-21836478 CTGTGAGCGAGGTTGGTGGCTGG - Intergenic
1123589293 15:21837736-21837758 CTGTGAGTGAGGTTGGTGGCTGG - Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1123827924 15:24101692-24101714 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123842383 15:24261103-24261125 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123857412 15:24427162-24427184 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123862043 15:24477694-24477716 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1124253479 15:28122511-28122533 CTGTGCGAGAGGCATGGGGCTGG - Intronic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1124475903 15:30034239-30034261 CTTTGGGAGAGCCAGGTGGGTGG + Intergenic
1124640449 15:31393154-31393176 CTGGGAGAGACGCAGGTGCCAGG - Intronic
1125097786 15:35874468-35874490 TTGGGATAGAGTCAGGTGGAGGG - Intergenic
1125152113 15:36544741-36544763 CTGCAAGAGGGGCATGTGGAAGG + Intergenic
1125434465 15:39630443-39630465 CTGACAGGGAGGGAGGTGGACGG - Intronic
1125573294 15:40737605-40737627 GTATGAGAGGGGCAGGTGGCAGG - Intronic
1125597440 15:40895886-40895908 CTGTGGAAGAGACAGGTGAAGGG - Intronic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1125862926 15:43014957-43014979 CTGTCAGGGAGGGAGGTGGGGGG + Intronic
1125866831 15:43059306-43059328 CTGTGAGAGGCTGAGGTGGAAGG - Intronic
1127269032 15:57384213-57384235 CTGGGTGTGAGGCAGCTGGATGG + Intronic
1127813787 15:62588390-62588412 CTTTGGGAGAACCAGGTGGATGG + Intronic
1127901697 15:63345726-63345748 CCCAGAGAGAGGCAGGTGGATGG + Intronic
1127948157 15:63776220-63776242 CTGTTAGATAGCCATGTGGAGGG - Intronic
1127965815 15:63922160-63922182 CAGTGAGATAGGAAGGTGGGTGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128314686 15:66653230-66653252 GGGTGAGAGAGGCAGTGGGAGGG + Intronic
1128794092 15:70452166-70452188 CCCTGAAAGAGCCAGGTGGAGGG + Intergenic
1128910443 15:71508969-71508991 CTGAGAGAGAGGGAGGAGGCAGG + Intronic
1128940344 15:71782940-71782962 CCGTGGGTGAGGCAGGTGGCTGG + Exonic
1128989332 15:72245703-72245725 CTTTGAGAGAGGGAGATGAAAGG + Intronic
1129063431 15:72880611-72880633 GGGTGAGAGAGGGAGGAGGAGGG + Intergenic
1129154422 15:73709108-73709130 TTGTGAGGTAGACAGGTGGAAGG + Intronic
1129389242 15:75212429-75212451 CTGGGAGAGAGGCACGTGCTGGG - Intergenic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1131091032 15:89625183-89625205 CTGTGGGAGAGGCGGGGGCAGGG - Exonic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1131890259 15:96964901-96964923 AGTTGAGAGAGGCTGGTGGAGGG - Intergenic
1132121484 15:99179727-99179749 CTCTCACAGAAGCAGGTGGAGGG + Intronic
1132136898 15:99350483-99350505 CTATTAGAGAGGCTGGTTGAAGG - Intronic
1132186187 15:99803890-99803912 CTGTGAGAGTGGCTGGGGGTAGG + Intergenic
1132354688 15:101162697-101162719 CTCTGGGAGAGCCAGCTGGAAGG - Intergenic
1202961182 15_KI270727v1_random:126288-126310 CTGTGAGCGAGGTTGGTGGCTGG - Intergenic
1202961396 15_KI270727v1_random:127568-127590 CTGTGAGTGAGGTTGGTGGCTGG - Intergenic
1132494349 16:253999-254021 CTGTGCTTGAGGCTGGTGGAAGG + Intronic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1132910633 16:2308876-2308898 GTGTCAGGGAGGCAGCTGGATGG - Intronic
1133153754 16:3857096-3857118 CTCTGAGAGTGGCAGGATGATGG - Intronic
1134136976 16:11683467-11683489 CTGAGAGACAAGCAAGTGGAAGG + Intronic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134692082 16:16197670-16197692 GTGGGAGAGATGCAGGAGGAGGG + Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1135180668 16:20271357-20271379 CTGAGAGAGAGGCAGGTAAGAGG + Intergenic
1135204914 16:20475479-20475501 ATGTGAGGGAGTCAGGGGGATGG - Intronic
1135213979 16:20548334-20548356 ATGTGAGGGAGTCAGGGGGATGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135467388 16:22698956-22698978 GTGGGAGAGAGAAAGGTGGAGGG - Intergenic
1135748792 16:25039739-25039761 CTGTGAGACAGGCTGGTGCTTGG + Intergenic
1135752595 16:25068887-25068909 CTGTCATACAGGCAGGTGGGTGG - Intergenic
1135758726 16:25119065-25119087 CTGTGAGACAGGCTGGTGCTTGG + Intronic
1135763098 16:25153432-25153454 CTGTGTGAGAGAGAGGTGAAGGG + Intronic
1136096836 16:27962960-27962982 GAGTGGGAGAGGCTGGTGGATGG - Intronic
1136165007 16:28447963-28447985 AAGTGAGAGAGGAAGGGGGAGGG - Intergenic
1136214305 16:28781194-28781216 AAGTGAGAGAGGAAGGGGGAGGG + Intergenic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136456926 16:30385282-30385304 TGGTGAGAGATGCAGGAGGAAGG - Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1136912111 16:34152955-34152977 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137482740 16:48865824-48865846 GAGTGAAAGAGGCAGGTGGGGGG - Intergenic
1137538230 16:49343546-49343568 CTGTGAGTGAGGCAGCTTGGAGG + Intergenic
1137604273 16:49776601-49776623 CTCTTAAAGAGGCAGGTGCAGGG + Intronic
1137668433 16:50265633-50265655 CTGTGATGGAGGAAGGTGCAGGG + Intronic
1138452771 16:57103647-57103669 CAGTGAGAGAGGCAGGCACAGGG - Intronic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1139393579 16:66622010-66622032 CTGAGAGACAGGCACGAGGACGG + Intronic
1139503389 16:67386724-67386746 CAGAGAGAGAGACAGGTGGAAGG + Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140236820 16:73166578-73166600 CTGGGAGAGAGGCAGGGAGGGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140629808 16:76837723-76837745 CTTTGAGAGAGCAAGGTGGGAGG + Intergenic
1140825421 16:78701601-78701623 GTGTGGGGGAGGCAGGTGGGTGG - Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141265753 16:82495458-82495480 GTGTGAGAGTGCCAGGGGGAGGG + Intergenic
1141270118 16:82531910-82531932 ATGAGGGAGAGGCAGATGGAAGG - Intergenic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142409863 16:89910493-89910515 CTGCGAGGGAGGCAGCTGGCAGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1143015625 17:3889838-3889860 CTTTGAGGGATGCAGCTGGATGG - Intronic
1143767785 17:9149034-9149056 CAGTGGGAGAGGCTGGTGCAAGG - Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144390668 17:14790716-14790738 GTGCGAGAGAGGCAGGCAGAAGG + Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1145868518 17:28255874-28255896 GTGGGAGGGAGGCAGGAGGAAGG + Intergenic
1146374854 17:32287188-32287210 ATGTGAGGGACGCAGGTGGATGG + Intronic
1147044923 17:37744926-37744948 GTGCGAGAGAGGAGGGTGGAGGG + Exonic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147199719 17:38792385-38792407 CTTTGAGAGACTGAGGTGGATGG - Intronic
1147888037 17:43697718-43697740 CTGTGAGGAAGGCGTGTGGAAGG + Intergenic
1147906340 17:43825543-43825565 GTCTAAGAGAGGCAGATGGAAGG + Intronic
1147930446 17:43977299-43977321 CTATCAGAGAGGAGGGTGGAAGG + Intronic
1147932927 17:43994377-43994399 CTGTGAGTGGGGCAGGGGAAGGG - Intronic
1148350277 17:46936508-46936530 CAGGGTGTGAGGCAGGTGGAGGG - Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148450845 17:47777132-47777154 CAGTGGGTGAGGCTGGTGGAGGG - Intergenic
1148561600 17:48609897-48609919 GAGCTAGAGAGGCAGGTGGAGGG - Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1148809934 17:50283901-50283923 CTGAGAGATAGGCAGGGGAAGGG - Intergenic
1148974126 17:51511918-51511940 CTGAGAGAGAGAGAGATGGAAGG + Intergenic
1149099439 17:52886039-52886061 CAGGGAGACAGGCAGCTGGAAGG - Intronic
1149445356 17:56708921-56708943 CTGATAAAGAGGGAGGTGGAAGG + Intergenic
1150411080 17:64941076-64941098 CAGACAGATAGGCAGGTGGATGG + Intergenic
1150832784 17:68539345-68539367 CTGGGAGAGAGGCGAGAGGATGG + Exonic
1150843135 17:68628109-68628131 CTGTGGGAGAGGCTAGTGGGAGG + Intergenic
1151023600 17:70650092-70650114 CTTTGGGAGACCCAGGTGGACGG - Intergenic
1151249585 17:72823535-72823557 CTTGGAGGGAGGCAAGTGGATGG - Intronic
1151375313 17:73684475-73684497 CTGGGAGGGAGGCAGGGAGAAGG + Intergenic
1151448430 17:74182239-74182261 CTGGGAGGGAGGCAGGGGAATGG - Intergenic
1151508064 17:74542285-74542307 CTGCGAGAGAGGCAGGGGAGAGG + Intronic
1151724355 17:75875845-75875867 CTGTGCGAGAGGCTGGCAGAGGG + Intronic
1151880089 17:76889501-76889523 CTGGGAGAGAGGCGTGTGGTTGG + Intronic
1152067075 17:78117781-78117803 CAGTGAGTGGGGCGGGTGGAGGG - Exonic
1152267100 17:79301517-79301539 CTGTGAGACTGGCCTGTGGATGG - Intronic
1152444987 17:80337260-80337282 CTGGTAGAGAGGCAGGCGGGCGG + Intronic
1152650805 17:81491774-81491796 GGGTGAGAGAGGGAGGGGGAGGG - Intergenic
1153054700 18:934486-934508 CTGTGAGGGAGGCTGGAAGAGGG + Intergenic
1153495964 18:5700023-5700045 GTATGAGAGAGGCAGGTGGCTGG - Intergenic
1154453740 18:14502465-14502487 CTGTGAGTGAGGTTGGTGGCTGG - Intergenic
1155040918 18:22065093-22065115 CTTTGAGAGACCAAGGTGGAAGG + Intergenic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155339409 18:24798980-24799002 CTCTGTGTGAGGCAGGTGCAGGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1157428382 18:47602937-47602959 AATTGAGAGAGGTAGGTGGAGGG + Intergenic
1157526937 18:48390746-48390768 TTTTGAGATAGGCATGTGGATGG - Intronic
1157867658 18:51199382-51199404 CTTTGAGAGGCCCAGGTGGAAGG - Intronic
1158094299 18:53753486-53753508 CTGGGAGAAAGGGAGGTGAAAGG + Intergenic
1158160075 18:54471439-54471461 CCGTGAGTGAGACAAGTGGATGG + Intergenic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1160036761 18:75309040-75309062 AGGAGAGAGAGGCAGGTGTAAGG - Intergenic
1160175611 18:76591808-76591830 CCGTGAGACAGGCAGTTGGGTGG - Intergenic
1161046099 19:2135873-2135895 CTGGGAGGGAGGAGGGTGGAGGG - Intronic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1161488056 19:4546366-4546388 CTGCGGGAGAGGGAGGTGGGTGG - Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162999494 19:14357253-14357275 CTTTGGGAGACTCAGGTGGAGGG + Intergenic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163634068 19:18430369-18430391 ATCTGAGAGAGGCTGGGGGATGG + Intronic
1163790507 19:19303336-19303358 CTCTCAGAAAGGTAGGTGGACGG - Exonic
1164177928 19:22793548-22793570 CTGTCAGAGGGGCAAGGGGAGGG - Intergenic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164405240 19:27938369-27938391 TTCTGGGAGAGGCAGGGGGATGG + Intergenic
1164573792 19:29393383-29393405 CAATGAGAGGGGGAGGTGGAGGG + Intergenic
1165329478 19:35133672-35133694 CTGTGAGTGAGGCCAGGGGATGG - Exonic
1165455687 19:35909331-35909353 CTTGGGGAGAGGCAGGTGGCTGG + Intergenic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165857717 19:38889913-38889935 TTGTCATAGAGGCCGGTGGATGG + Exonic
1166167810 19:41004487-41004509 CACTGAGAGATGCAGGTGCACGG + Intronic
1166167906 19:41005253-41005275 CTGTGAGACATGTAGGTGAAGGG + Intronic
1166231603 19:41428107-41428129 GGTTGAGAGAGGCAGGTGGAGGG + Intronic
1166257581 19:41617600-41617622 AAGTGAGAGAGGGAGGTGGGAGG + Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166698368 19:44867263-44867285 CTTTGAGAGGCCCAGGTGGACGG - Intronic
1167042838 19:47032710-47032732 CTGTGAGAGACCCAGATAGATGG - Exonic
1167674893 19:50877882-50877904 CTGTGAGGGAGGCTGGGTGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167742346 19:51331287-51331309 CAGTGATAGAGGGAGGTAGAGGG + Intergenic
1167966942 19:53155771-53155793 CTGTGAGTGAGGCTGGTACATGG + Intronic
1168165314 19:54543167-54543189 CCATGAGAGAGGCAGAAGGATGG + Intronic
1168239913 19:55083798-55083820 CTGGGAGAGAGGGAGGAGCAGGG + Intronic
925352124 2:3208807-3208829 CTGTGAGTGAGGCCCGTGGCAGG + Intronic
925774319 2:7319190-7319212 CTGAGGGAGAGGGAGGTAGAAGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926238035 2:11063527-11063549 CTGTCATGGAGGCAGGAGGAGGG + Intergenic
926360929 2:12086069-12086091 CTGTGAGAGGCCAAGGTGGATGG + Intergenic
926589058 2:14720265-14720287 GTGTGAGAGAGGGAGAGGGAGGG - Intergenic
927510562 2:23641490-23641512 CTCTGAGGGAGGCAGGGGAAGGG - Intronic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
927970183 2:27300944-27300966 CTCTAACAGAGGCAGGAGGATGG - Intronic
928111273 2:28510869-28510891 CTTTGAGAGACCGAGGTGGAAGG - Intronic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928403507 2:30996476-30996498 GTGCTGGAGAGGCAGGTGGAGGG + Intronic
929081885 2:38129537-38129559 CTGAGAGAAAGGGAGGAGGAAGG - Intergenic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
930227499 2:48809138-48809160 CTATGAGAGAGGCTGGTGATGGG - Intergenic
930871121 2:56172020-56172042 GTGTGAGGGAGGCAGGTACAGGG + Intergenic
930923491 2:56787183-56787205 CTGAGAGAGAAACAGGTTGATGG - Intergenic
930926658 2:56826459-56826481 CTGAGAGAGAGGAGTGTGGAAGG + Intergenic
931516040 2:63051269-63051291 CTGTGAGAGATCCAGGTAGATGG + Exonic
932084878 2:68749098-68749120 GTGAGGGAGAGGCAGATGGAAGG + Intronic
932643356 2:73474581-73474603 CTTTGAGAGACTGAGGTGGAAGG - Intronic
933698892 2:85240264-85240286 TTGTGAGAGAGGGAGGTGCAGGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934019854 2:87936710-87936732 CTGAGAGAGAAGCAGGAGAATGG + Intergenic
934301941 2:91781575-91781597 CTTTGAGAGAGGCATGGGGAAGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
935302144 2:101702321-101702343 CTTTGAGAGGCGCAGGTGGGCGG + Intronic
935529187 2:104211936-104211958 CTCTGAGAGAGGACTGTGGAAGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
935985280 2:108666547-108666569 CTTTGAGAGACTCAGGTGGGAGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936137712 2:109910195-109910217 CTTTGAGAGACTCAGGTGGGAGG + Intergenic
936206985 2:110461290-110461312 CTTTGAGAGACTCAGGTGGGAGG - Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
938953507 2:136278466-136278488 GTGTGAGAGAGGCAAGTTCATGG - Intergenic
940194639 2:151080195-151080217 CTGAGAGAGAGGACGGTGGGTGG + Intergenic
940810754 2:158240123-158240145 CTGTGAGAGATCTCGGTGGATGG + Intronic
941602908 2:167563415-167563437 CTGTCCGGGAGGGAGGTGGAGGG - Intergenic
941647470 2:168056830-168056852 CTGTGTGATAGGGAGCTGGAAGG - Intronic
942398298 2:175575324-175575346 ATGTGAGAGAGAGAGATGGAAGG - Intergenic
942410042 2:175699694-175699716 AGGTGAGAGATTCAGGTGGATGG - Intergenic
942410684 2:175706121-175706143 AGGTGAGAGATTCAGGTGGATGG - Intergenic
942453337 2:176122058-176122080 GTGTGAGTGTGGCAGGGGGAGGG + Intergenic
943568229 2:189542186-189542208 TGCAGAGAGAGGCAGGTGGAAGG - Intergenic
943806010 2:192127093-192127115 CTGTCAGAAAGCCTGGTGGAGGG - Intronic
944561226 2:200940556-200940578 CTTTGAGAGGCCCAGGTGGATGG + Intronic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
945520585 2:210822420-210822442 CTGTCAGAGGGGCATGGGGAGGG + Intergenic
945856052 2:215071324-215071346 CTGTCAGATAGGCAGGGTGAGGG + Intronic
945868125 2:215199435-215199457 CTGAGACAGAGGCTGGTGGGTGG + Intergenic
945927137 2:215817329-215817351 CTGTGAGTGAGGCTCATGGAAGG - Intergenic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946304909 2:218850963-218850985 CTGTGATAGAGGCATGGGCAGGG + Intergenic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946445918 2:219739942-219739964 CTGTGAGCGAGATAGTTGGAGGG + Intergenic
948020849 2:234732101-234732123 CTTTGGGAGAGCAAGGTGGACGG - Intergenic
1170134182 20:13055010-13055032 CTAGGAAAGAGGCAGGTGGAAGG + Intronic
1170238918 20:14140819-14140841 CCGAGAGAGAGGCAGCTGGTGGG + Intronic
1170877931 20:20267929-20267951 CAATGAGACAGGCAGGTGGGAGG - Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1170922792 20:20694764-20694786 GTGTAAGCGAGGCAGGTGCAGGG + Intronic
1170934132 20:20795277-20795299 GTGTGTGAGAAGCAGGTTGAGGG + Intergenic
1171017317 20:21553501-21553523 CTTTGAGAGACTGAGGTGGAAGG + Intergenic
1171250769 20:23645315-23645337 CTGGGAGCGAGGGAGATGGAGGG - Intergenic
1171784021 20:29447328-29447350 CTTGGAGAAAGGCGGGTGGACGG + Intergenic
1171795256 20:29561389-29561411 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1171839960 20:30197452-30197474 CTGTGGGATAGAGAGGTGGAAGG - Intergenic
1171853200 20:30322876-30322898 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1171907416 20:30911112-30911134 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1171958340 20:31476108-31476130 ATGACAGACAGGCAGGTGGAGGG - Intronic
1172061129 20:32188250-32188272 ATGTGAGTGAGGCAGGGGCAAGG - Intergenic
1172077157 20:32307989-32308011 CTTTGAGAGAATGAGGTGGAGGG + Intronic
1172078864 20:32322363-32322385 CTTTGAGAGGCCCAGGTGGACGG + Intronic
1172123433 20:32611575-32611597 ATGTGAGGGAGGCAGATGGGAGG - Intergenic
1172168007 20:32910604-32910626 CAGTGAGAGAGGGTGGTGGCAGG - Intronic
1172317677 20:33968888-33968910 GAGTCAGAGAGGCAAGTGGAAGG + Intergenic
1172477370 20:35248956-35248978 CTCAGAGAGTGGCAGGTGGATGG + Intronic
1172502173 20:35435082-35435104 CTGGGAGAGAGATAGGTAGAAGG - Exonic
1172647143 20:36477652-36477674 CTGAGGCTGAGGCAGGTGGAGGG - Intronic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1173251040 20:41364371-41364393 TGGTCAGAGAGGCAGATGGACGG + Intronic
1173541681 20:43857342-43857364 GTGTGAGAGAGGGAGGAGGGAGG + Intergenic
1173731676 20:45333245-45333267 CTGTGAAAGAGCCAGGGGGTGGG - Intronic
1173928451 20:46798508-46798530 CTGAGAGAGAGGCAGGAGGCAGG - Intergenic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1174521076 20:51131260-51131282 CTCTGCGAGAGGCTGGTGGCCGG + Intergenic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1174971564 20:55281406-55281428 CTTTGAGAGAGGTAGGGTGAAGG + Intergenic
1175169419 20:57069877-57069899 CTGGTGGAGATGCAGGTGGAGGG - Intergenic
1175385425 20:58591900-58591922 ATGTGAGGGAGGCAGGAGGTCGG + Intergenic
1175544862 20:59771590-59771612 CTGGGAGAGAGAGTGGTGGAGGG - Intronic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1176017983 20:62946680-62946702 CTGGGAGAGTGGTAGTTGGAAGG - Exonic
1176408997 21:6437591-6437613 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179459837 21:41526867-41526889 GTGTGTGAGATGCACGTGGAAGG + Intronic
1179538562 21:42068413-42068435 CTGTCAGAGAGCCACCTGGATGG + Intronic
1179684490 21:43045913-43045935 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1179771599 21:43623045-43623067 CTATGAGAGACTCAGGTGGGAGG - Intronic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1180340838 22:11617254-11617276 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1180814490 22:18781144-18781166 CCTTGAGAGAGGCATGGGGAAGG - Intergenic
1181200678 22:21215480-21215502 CCTTGAGAGAGGCATGGGGAAGG - Intronic
1181701063 22:24621493-24621515 CCTTGAGAGAGGCATGGGGAAGG + Intronic
1181996661 22:26888204-26888226 CTTTGAGAGACGGAGGTGGGTGG + Intergenic
1182509293 22:30807574-30807596 CTGTGTGAGAGGCAGGGAGCTGG - Intronic
1182584313 22:31335146-31335168 CCTTGAGAGAGGAAAGTGGAAGG - Intronic
1182677396 22:32050372-32050394 CTGGGATAAAGGCAGATGGAGGG - Intronic
1183752872 22:39732080-39732102 CTGTGAGACCTGCAGGGGGATGG - Intergenic
1183792509 22:40084348-40084370 GTGTGAGTGAGGCAGATTGAAGG + Intronic
1183944545 22:41317544-41317566 CTGTGGGAGACTCAGGTGGGAGG + Intronic
1184233173 22:43169281-43169303 CTGAGAGGGAGGGAGCTGGAGGG - Intronic
1184467942 22:44679908-44679930 CTACGAGGGAGGCAGGTGTATGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184850195 22:47115464-47115486 GTGGGAGAGTGGCAGATGGAAGG - Intronic
1184918096 22:47587053-47587075 CAGTGAGGCAGGCAGGTGGCTGG + Intergenic
1185161341 22:49231750-49231772 CTAGGAGAGAGGAAGGTGAAAGG - Intergenic
1185346345 22:50312502-50312524 CGGTGAGAGAGGCTGGGGGTTGG - Exonic
1203226239 22_KI270731v1_random:79955-79977 CCTTGAGAGAGGCATGGGGAAGG + Intergenic
1203264589 22_KI270734v1_random:6831-6853 CCTTGAGAGAGGCATGGGGAAGG - Intergenic
950080528 3:10218952-10218974 CTTTGGGAGAGCGAGGTGGACGG + Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950164026 3:10780150-10780172 AAGTGAGAGAGGAAGGAGGATGG - Intergenic
950452755 3:13074352-13074374 GTGTGCGACAGGGAGGTGGAGGG + Intergenic
950520115 3:13493160-13493182 CTGTGGGTGGGGCAGGTGGGGGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950659357 3:14457243-14457265 CTCAGAGAGAGGCAGGTAAACGG - Intronic
950681081 3:14585506-14585528 CTGGGACCGAGGCAGCTGGAGGG + Intergenic
950733935 3:14989549-14989571 CTTTGAGAGGCCCAGGTGGAAGG + Intronic
951039907 3:17978582-17978604 TTGTAAGAGAAACAGGTGGAAGG - Intronic
951419379 3:22466323-22466345 CTGTCAGAGAGCGGGGTGGAGGG - Intergenic
952726995 3:36597034-36597056 ATGTGAGAGAGGGAGGAGAAGGG - Intergenic
952848869 3:37711645-37711667 CTGTGAGAGGCTCAGGTGGGAGG - Intronic
953405204 3:42656519-42656541 CTGGGACAGAGGGAGATGGATGG + Intronic
953697829 3:45173449-45173471 CTGGGAAAGAGGCACCTGGATGG - Intergenic
953890681 3:46749959-46749981 CTATGAGAGAGGATGGTGGAGGG + Intronic
954026917 3:47790349-47790371 CGGTGACAGAGGCAGGAGAATGG - Intergenic
954356013 3:50084462-50084484 CTGTCCGGGAGGGAGGTGGAGGG - Intronic
954825801 3:53372371-53372393 CTTTGAGAGGCCCAGGTGGATGG + Intergenic
954876133 3:53804285-53804307 ATTTGAGAGAGGCACGGGGAAGG - Intronic
954996696 3:54888307-54888329 CCGAGAGAGAGGGAGGCGGAAGG + Intronic
955034879 3:55257926-55257948 GTGGGAGAGAGGAAGGGGGAGGG - Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
956116685 3:65926381-65926403 CTCTGACAGAGGGAGGTGTAGGG - Intronic
956685798 3:71826081-71826103 CTGTTAGATAGGTGGGTGGATGG + Intergenic
957198958 3:77107322-77107344 TTGTAAGAGAGGCAGGTGTTTGG + Intronic
958025090 3:88040289-88040311 CAGTGATACAGGCAGGTGGGAGG - Intergenic
958504257 3:94954035-94954057 GTGAGAGAGAGGGAGGGGGAAGG + Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
960031929 3:113062850-113062872 AAGTGAGAGAGGCAGTTGGAAGG - Intergenic
960373787 3:116873433-116873455 GTGAAAGAGAGGCAGTTGGAAGG + Intronic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960997310 3:123348654-123348676 GTGGGAGAGAAGCAAGTGGAGGG + Intronic
961104760 3:124231515-124231537 CTTTGAGAGATGCAGGTCCAGGG - Intronic
961457655 3:127032171-127032193 CTGCGTGAGATGCAGGTGGTGGG + Intronic
961666722 3:128497429-128497451 CTGAGAGAGGGGCACGGGGAAGG + Intergenic
961809489 3:129513762-129513784 CTGGGAGAGATGCGGGAGGAAGG + Intronic
963301606 3:143603346-143603368 ATGTGAGAGAGGAATGTAGAGGG - Intronic
963320909 3:143807989-143808011 CGGTGAGAGAGGATGGTGGCCGG + Intronic
963666478 3:148194579-148194601 CTGTGAGAGAGGAAGCTGGTTGG + Intergenic
964763320 3:160154770-160154792 CTGTGAGAGAAGAAGCTGGCTGG + Intergenic
965219193 3:165904367-165904389 CTGTGAAAGATACAGGGGGAGGG - Intergenic
965355660 3:167670076-167670098 CAGTGAGAGAGGAAGCTGAAAGG - Intergenic
965375355 3:167916207-167916229 CGGGGAGAGAGGCAGGGGGCAGG + Intergenic
966257515 3:177934433-177934455 CATACAGAGAGGCAGGTGGAGGG + Intergenic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967301569 3:188019481-188019503 CTGAGAGAGGCGCAGGTGAAGGG + Intergenic
967491846 3:190101133-190101155 CAGGGAGAGAGACAGGTGAATGG - Intronic
967707883 3:192673535-192673557 CTGTCAGGGGGGCAGGAGGAGGG - Intronic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
968638420 4:1696024-1696046 CTGGGAGGGAGGCAGCTGGAAGG - Intronic
968821371 4:2854371-2854393 GTGTGAGAAAGGGAGGTGCAAGG + Intronic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969213491 4:5706172-5706194 CCGTGAGAGAGGGTGGAGGAAGG - Intronic
969285070 4:6197990-6198012 CTGTCAGAGAGTCATGTGCAGGG - Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
970289075 4:14552071-14552093 CTGCGAGAGAGGCAAATGGAGGG + Intergenic
971717457 4:30197682-30197704 CTTTGAGAGACTGAGGTGGAAGG + Intergenic
971733098 4:30411009-30411031 GTGTGAGAGAGGGAGATGGGTGG + Intergenic
971802463 4:31309755-31309777 CTGTGAGTGAGGTGAGTGGAAGG - Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
973214076 4:47649194-47649216 CCGTGAAAGAGGCAGGATGAAGG + Intronic
974579561 4:63778289-63778311 CTCAGAGAGAGGCATGTGGAGGG - Intergenic
975952016 4:79785380-79785402 CAGTGAGAGAGCCGTGTGGAGGG - Intergenic
976788007 4:88844664-88844686 CAGTTGGAGAGGCAGGTAGAGGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
978766728 4:112412177-112412199 CTGGCAAAGAGGCGGGTGGAAGG - Intronic
978974915 4:114857850-114857872 CTAAGAAAGAGGCATGTGGATGG + Intronic
979502924 4:121460834-121460856 CTGAGAGAGAGACAGGGGGAAGG + Intergenic
979551993 4:122001880-122001902 CTGTGTGTGATGCTGGTGGATGG + Intergenic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
980726597 4:136769817-136769839 TTTTGAGACAGCCAGGTGGAAGG + Intergenic
980973513 4:139588793-139588815 CTGAGAGACAGCCAGGTGCAAGG - Intronic
981641363 4:146946984-146947006 CTGTGAGAAAGGAAGGTGCATGG - Intergenic
981742768 4:148020443-148020465 CTGTCAGCGGGGCAGGGGGAGGG - Intronic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
982294315 4:153811102-153811124 CTTTGAGAGACTGAGGTGGAAGG + Intergenic
982711623 4:158763680-158763702 CTGTAAGATTGTCAGGTGGATGG + Intergenic
984428556 4:179619534-179619556 CTGAGGGAGAGGCAGGTATAGGG - Intergenic
984501469 4:180564598-180564620 CTGTGCGAGAAGCAGATGTAAGG - Intergenic
985027161 4:185749191-185749213 CTGGGAGGGAGACAGGTGCAGGG + Intronic
985522960 5:387557-387579 CAGGGTGAAAGGCAGGTGGAGGG - Intronic
985840500 5:2301824-2301846 CTGAGAGAGAGGCAGAGGGACGG - Intergenic
986018625 5:3780463-3780485 CTTTGGGAGACTCAGGTGGAAGG - Intergenic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
987575080 5:19716060-19716082 CTTTGGGAGACCCAGGTGGACGG - Intronic
988836932 5:35042770-35042792 GTGTAAGAGATGGAGGTGGAGGG + Intronic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
990463785 5:56053405-56053427 CAGTGAGAAAGGGAGCTGGAAGG - Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990823743 5:59873965-59873987 CTGTGAGAGACTGAGGTGGGAGG + Intronic
992335388 5:75762831-75762853 CTGTCAGTGGGGCAGGAGGAGGG - Intergenic
992648879 5:78837869-78837891 CAGTGAGAGAGGCAAGGGCAAGG - Intronic
993057676 5:83001181-83001203 CTTTGAGACAGGCAGGTAGGAGG - Intergenic
993165796 5:84353306-84353328 CTGGCAGAAAGGCAGGTGGTAGG + Intronic
994505531 5:100639133-100639155 CTTTGAGACAGTCAGGTGGGAGG + Intergenic
995393904 5:111667086-111667108 TTGTGAGACAGCCAGGTGGGAGG - Intronic
995429532 5:112058776-112058798 CTTTGAGAGATAAAGGTGGAAGG - Intergenic
995591061 5:113699941-113699963 CTGTGGGAGAAGCAGGTGCAGGG - Intergenic
996281360 5:121732915-121732937 CTATTAGTGAGGCAGATGGAAGG - Intergenic
996393321 5:122987150-122987172 CTGGGAGAGAGGGTGGAGGAAGG + Intronic
996439201 5:123470799-123470821 CTGTTATAGATGCAGGTGGGAGG - Intergenic
996774492 5:127119303-127119325 CTGGGGTAGAGGCATGTGGATGG + Intergenic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
997578775 5:135004473-135004495 ATGAGAGGAAGGCAGGTGGACGG + Intronic
997660432 5:135585223-135585245 TGGTGAGAGAGGCAGGAGGTGGG - Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
997871141 5:137506081-137506103 CTGTGAGGGACGCAGGGAGATGG - Intronic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999490337 5:152044067-152044089 CTGTGGGCAAAGCAGGTGGACGG + Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999625561 5:153517017-153517039 ATGAGAGAGAGGCAGGAGGTGGG + Intronic
999743422 5:154574116-154574138 CTGAGGGAGAGGCAGGTGCGTGG - Intergenic
1000159455 5:158583292-158583314 CTGTCCGGGAGGCAGGTGGGGGG + Intergenic
1000166796 5:158657544-158657566 GTGTGAGTGAGGAAGGTGGTAGG - Intergenic
1000298555 5:159934380-159934402 CGGTGACAGAGGCAGGTGACAGG - Intronic
1000418414 5:161009249-161009271 CTGTGAGAGATGCTAGGGGATGG - Intergenic
1000841053 5:166219072-166219094 CAGGGAGAGAGAAAGGTGGAAGG + Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001706001 5:173741660-173741682 CTGAGAGAGAGGGAGGGAGAGGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002181994 5:177435437-177435459 CTGTGAGGGAGGCCAGTGGAGGG + Intronic
1003242555 6:4357542-4357564 ATGTGAGAAAGGCAGATGGCAGG + Intergenic
1003744464 6:8984313-8984335 CTTTGGGAGACCCAGGTGGAAGG - Intergenic
1005063458 6:21797247-21797269 CCGGGAGAGAGGGAGGTGGGGGG - Intergenic
1005477358 6:26220621-26220643 CTGAGAGACAGGCACTTGGAGGG - Intergenic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005963140 6:30707600-30707622 CTGGGAGCCAGTCAGGTGGAAGG - Exonic
1006338452 6:33432856-33432878 CTGTGTGAGATGCAGAGGGAGGG + Intronic
1006355810 6:33557085-33557107 ATGTGAGAGAGACACATGGAGGG + Intergenic
1006411737 6:33877858-33877880 CTGGGGGAGAGGCAGGAGAAGGG - Intergenic
1006901983 6:37508563-37508585 CTGTGAGAGAGGCAAGTGTAAGG + Intergenic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007240713 6:40423055-40423077 CAGTGAGAGAGGCAGGATGTGGG + Intronic
1007292536 6:40798402-40798424 CTGGGAGAGAGGAAGAGGGAGGG + Intergenic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007744369 6:44034467-44034489 CAGGGAGAGAGGCAGGGGAAGGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1007838610 6:44697325-44697347 CAGAGGGAGAGGCAGCTGGAGGG + Intergenic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1009715039 6:67380210-67380232 CTGAGAGAGAGGGAGGAAGAAGG + Intergenic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1010453119 6:76025938-76025960 TGGTGAGAGAGCCAGGTGGGAGG + Intronic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1011589619 6:88959424-88959446 CTGAGAGAGAAGCAGGTTGGAGG - Intronic
1011694046 6:89896015-89896037 TTGACAGAGAGGCAGATGGAGGG + Exonic
1012308405 6:97689154-97689176 TAGTGAGATAGCCAGGTGGAAGG + Intergenic
1012428382 6:99139809-99139831 GTGTGAGAGAGGCGGGGGGGCGG - Intergenic
1012973134 6:105752770-105752792 GGGTCAGAGAGGTAGGTGGATGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013323834 6:109024190-109024212 CTCTAAGAGAGGCAGGTGAAGGG - Intronic
1014258963 6:119194565-119194587 CTGTGAGAGGCCCAGGTGGGAGG - Intronic
1014912409 6:127110814-127110836 GTGTGAGAGAGGAAGTTGCAAGG - Intergenic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1015882359 6:137881739-137881761 CTCTGAGAGATGCTGGGGGAGGG - Exonic
1015937634 6:138418953-138418975 CTGGGGTAGAGGCATGTGGATGG + Exonic
1015980574 6:138833976-138833998 CTTGGAGAGAGGCCTGTGGAGGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016530882 6:145057162-145057184 GTGTGAGAGATACTGGTGGAGGG + Intergenic
1016956061 6:149627820-149627842 CTGAGGGAAAGGCAGGTGAAAGG + Intronic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1018524459 6:164692961-164692983 CAGTGAGAGGGGCAGCTGAACGG - Intergenic
1018893450 6:167997627-167997649 CAGTGAGAGACGTGGGTGGAAGG - Intronic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019564988 7:1674701-1674723 CAGTGGGAGAGACTGGTGGAAGG + Intergenic
1019953186 7:4390234-4390256 CCGTCAGGGAGGGAGGTGGAGGG - Intergenic
1021064468 7:16156512-16156534 CTGTGGGAGAGGCAGAAGTATGG - Intronic
1022591213 7:31665070-31665092 TAGTGAGAGAGGAAGGAGGAAGG - Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023160614 7:37292773-37292795 CTGGGAGGGAGGGAGGTGGGGGG + Intronic
1023472253 7:40536340-40536362 CTCTGAGACAGGCAGGGAGAAGG + Intronic
1024324957 7:48102222-48102244 GTGTGAGGGTGGCAGGTGCAGGG + Intronic
1024527219 7:50359014-50359036 CTTTGAGAGACTGAGGTGGAAGG + Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026250544 7:68666217-68666239 CAGAGAGAGAGGCAGGAAGAGGG - Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1028032188 7:85930238-85930260 GTGAGAGAGAGGGAGGTGGGTGG - Intergenic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028625381 7:92871348-92871370 CTGTGAGATGTGCAAGTGGAAGG + Intergenic
1028738297 7:94243406-94243428 CTTTGAGACAGCCAGGTGGGAGG + Intergenic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029378141 7:100194541-100194563 CTTTGGGAGAGTGAGGTGGAAGG + Intronic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1030322634 7:108185490-108185512 CTTTGGGAGACCCAGGTGGATGG + Intronic
1030658075 7:112190327-112190349 CCCTGAGAGAGGCAGCTGCAGGG + Intronic
1030675673 7:112383378-112383400 CCCTGGGAGAGGCAGGTGGGTGG - Intergenic
1030958493 7:115885789-115885811 CTGTGAGATATTCAGATGGAGGG - Intergenic
1031706607 7:124988460-124988482 ATATGAGAGAGGCAACTGGAAGG + Intergenic
1032500620 7:132396998-132397020 CTGTCAGAGTGGCAGGTGTCTGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033118140 7:138644592-138644614 CTGTCTGAGAGGCAGGGCGATGG - Intronic
1033242737 7:139694226-139694248 CTGTGAGAGTTACAGGAGGATGG - Intronic
1033600656 7:142886120-142886142 CAGAGAGTGAGGCAGGTGGTCGG - Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034411589 7:150945171-150945193 CAGTGAGAGGGGCAGGGGCAGGG - Exonic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034903550 7:154923553-154923575 TTGTGAGAGCGGCAACTGGACGG + Intergenic
1035433801 7:158842454-158842476 CACTCAGAGAAGCAGGTGGACGG - Intergenic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1037586271 8:20278478-20278500 CTGTGAGAGAGTCAAGTGTACGG - Intronic
1037739644 8:21597992-21598014 ATGGGAGAGAGGCAGGAGGGAGG + Intergenic
1037829068 8:22177544-22177566 CTGGGAGAGAGGGAGGAGGCGGG - Intronic
1038311715 8:26450059-26450081 CTGAGAGAGGGGCAGCTGTAGGG + Intronic
1038429760 8:27491006-27491028 CCGGGAAAGAGGCAGGGGGAGGG - Exonic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039593933 8:38774223-38774245 CTCTGAGAATGGCTGGTGGACGG - Intronic
1039621415 8:39000280-39000302 CTGTGAGAGAGGCTGGGGCGCGG - Intronic
1040392771 8:46963833-46963855 AAGAGAGAGAGGCAGGTAGACGG + Intergenic
1041248051 8:55907621-55907643 CTTTGAGAGACCCACGTGGAAGG + Intronic
1041607658 8:59802194-59802216 GTGTGTGTGAGGGAGGTGGAAGG - Intergenic
1041810463 8:61902886-61902908 ACGTGAGAGAGTCAGGTGCACGG + Intergenic
1042770857 8:72380798-72380820 CAGTGACAGAGAGAGGTGGAGGG + Intergenic
1042941399 8:74112344-74112366 CAATGAGAGAGGTGGGTGGAGGG + Intergenic
1043496318 8:80804671-80804693 CTGTCAGAGTGGGAGGTGGGAGG + Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045608274 8:103803761-103803783 CTGTGAGAGAGCCATGTGTCAGG + Intronic
1046247311 8:111581419-111581441 CTGTCAGAGAGGCAATGGGAGGG - Intergenic
1047088188 8:121543118-121543140 CTTTGAGAGACTGAGGTGGAAGG - Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1048437383 8:134431223-134431245 CTGGGAGAGATGAAGGTAGACGG + Intergenic
1048445092 8:134487387-134487409 CTGTGAGGAAGGCAGGGTGAGGG + Intronic
1048671955 8:136732454-136732476 ATGTGGGGGAGCCAGGTGGAGGG - Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049361095 8:142212919-142212941 ATGGGAGAGAGGGAGGGGGAGGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049612608 8:143562425-143562447 CTGGGAGAGAGTCAGGTAAAAGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1050027799 9:1353923-1353945 GTTTGAGAGGGGCAGGTAGAGGG + Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1051326444 9:15975943-15975965 TTGTAAGAGAGGGAGGTGCAGGG + Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051735172 9:20190323-20190345 ATCTGAGAGAGGTAGGAGGATGG - Intergenic
1052011394 9:23413899-23413921 CTGTGAGAGAGGCAAGTATTTGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052447427 9:28581267-28581289 CTGTGAGAGATGCAGTTGTTGGG - Intronic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1053410241 9:37911606-37911628 CTGTGAGAGAGCCAGGGTCAGGG - Intronic
1053600708 9:39606182-39606204 CTGTGAGAGAGGGGAGTGTAAGG + Intergenic
1053790994 9:41686175-41686197 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054154156 9:61628597-61628619 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054179340 9:61897869-61897891 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054473944 9:65559717-65559739 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054658198 9:67682952-67682974 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054743750 9:68833887-68833909 ATGTCAGAGAGGCAAGTGGGTGG + Intronic
1054787336 9:69221793-69221815 CTGTGAGAGATTCAGGTGGACGG - Intronic
1054852592 9:69864000-69864022 CTGTGTGAGAAGCAGGTCCATGG + Intronic
1055235744 9:74120722-74120744 CTGTGAGGCAGGCAGGAGTAGGG + Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056628611 9:88274552-88274574 CTGTGAGTGAGGCAGGGTGGTGG - Intergenic
1056767203 9:89452123-89452145 GTGTGCCAGAGGCAGCTGGATGG + Intronic
1056837757 9:89971053-89971075 CTGTGAGACACGCACGTGTACGG - Intergenic
1057093839 9:92286122-92286144 CTTTGAGAGATCAAGGTGGATGG + Intronic
1057112994 9:92491986-92492008 CAGTGAGGGAAGCAGATGGAGGG - Intronic
1057134500 9:92677922-92677944 GTAAAAGAGAGGCAGGTGGAGGG - Intergenic
1057545773 9:96019853-96019875 GTGAGAGAGAGGAAGGGGGACGG + Intergenic
1057972343 9:99570178-99570200 CTGTGAGGGAGGCAGAGGGCAGG - Intergenic
1058326627 9:103706595-103706617 CTGAGAGAGAGTCATGTGGCAGG - Intergenic
1058507213 9:105678279-105678301 CTGTGACAGAGACAGGTGTGTGG - Intergenic
1059051786 9:110934276-110934298 CTGTGGGAGAGCCATGTGGCAGG - Intronic
1059350840 9:113663698-113663720 TTCTGGGAGAGGCAGTTGGAAGG + Intergenic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1059715513 9:116909476-116909498 CTGTGGGAGAAACAGGTTGAGGG + Intronic
1059736264 9:117102943-117102965 CTGTGAGAGAGACAGGGAGAGGG + Intronic
1060107081 9:120879278-120879300 ATGTGAGACACACAGGTGGATGG + Intronic
1060196929 9:121629756-121629778 ATGTGACTGAGGCAGGTGGGTGG + Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060376547 9:123119640-123119662 GTGTTGGAGAGGCAGGTGCATGG - Intronic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1060860809 9:126953410-126953432 AGGTGAGAGAGGCAGAAGGAGGG + Intronic
1061394809 9:130338059-130338081 CTGAGAGACAGGCAGGGTGATGG - Intronic
1061425799 9:130497718-130497740 TTGTGAGAGATGGAGGTGAAGGG + Intronic
1061642645 9:131971362-131971384 GGGAGAGAGAGGGAGGTGGAAGG + Intronic
1061857199 9:133448868-133448890 CTTGGAGTGAGGCAGGGGGATGG - Intronic
1061990521 9:134156278-134156300 CTGTGAGCGAGGCCGGTGCTGGG + Intronic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1186139202 X:6553287-6553309 CGGGGAGAGAGGGAGGTGCAAGG + Intergenic
1186207232 X:7213542-7213564 CTATGAGGAAGGCAGATGGAGGG + Intergenic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1186700696 X:12086993-12087015 CTGTCAGAGAGGCCTGTGAAAGG - Intergenic
1186959111 X:14715747-14715769 CTATGAGAGAAGTAGGTGTAAGG + Intronic
1187128219 X:16474469-16474491 ATGTGGTAGATGCAGGTGGAGGG + Intergenic
1187417290 X:19104221-19104243 CAGTGAGGGAGGCCTGTGGAAGG + Intronic
1187949781 X:24460475-24460497 CTGAGAGAGAGAGAGGTGGGGGG + Intergenic
1189152866 X:38725933-38725955 TAGTGAGACAGCCAGGTGGAAGG + Intergenic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189252335 X:39611038-39611060 GTGTGGGACGGGCAGGTGGAAGG + Intergenic
1189700996 X:43716233-43716255 GGGTGAGACAGGTAGGTGGATGG + Intronic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1191273466 X:58510781-58510803 GTGGCAGAGAGGCTGGTGGAGGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191910536 X:66144576-66144598 ATGTGAGACAGTCAGGTGAAAGG + Intergenic
1192087107 X:68111316-68111338 CACTGAGATAGGCAGGTGAAAGG - Intronic
1194373867 X:93109248-93109270 CGGTGAGAGAGGGAGTGGGAGGG + Intergenic
1195763755 X:108274792-108274814 CTGTGAGAGGGCCATGTGGCTGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195959162 X:110367672-110367694 CTGTGGGAGAAGCAGGTATAAGG - Intronic
1196214131 X:113030385-113030407 CTGTCAGTGGGGCAGATGGAGGG + Intergenic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1198299163 X:135317650-135317672 CTGTGGTAGAGGCAGCTGGGTGG + Intronic
1198378450 X:136061976-136061998 CTCCTAGAGAGGCAGGTGGTGGG + Intergenic
1199124673 X:144102421-144102443 CTGAGAGAGAAGCAGGAGAATGG - Intergenic
1199188262 X:144940624-144940646 CTGTGAGAGAGCCATGTAGCGGG + Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199535269 X:148895595-148895617 GTGTAAGAGAGGGAGGGGGAGGG + Intronic
1199601992 X:149546532-149546554 CGCTGGGAGAGGCAGGGGGAGGG - Intronic
1199648396 X:149932952-149932974 CGCTGGGAGAGGCAGGGGGAGGG + Intronic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1200064942 X:153499784-153499806 CTGGGAGAGTGGCAGGGGGCAGG + Intronic
1200203051 X:154295706-154295728 CGGAGGGAGCGGCAGGTGGAGGG + Exonic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1200681896 Y:6223310-6223332 CGGTGAGAGAGGGAGTGGGAGGG + Intergenic
1201075414 Y:10183545-10183567 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1201579049 Y:15492150-15492172 CTGTGAGGAAAGCAGATGGAGGG + Intergenic