ID: 1072566570

View in Genome Browser
Species Human (GRCh38)
Location 10:96621396-96621418
Sequence TGGGGTTCTGAAGATTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072566570_1072566575 4 Left 1072566570 10:96621396-96621418 CCAGCATAATCTTCAGAACCCCA 0: 1
1: 0
2: 5
3: 14
4: 159
Right 1072566575 10:96621423-96621445 TGAGAGACGACTCCAGGAAAAGG 0: 1
1: 0
2: 1
3: 18
4: 171
1072566570_1072566577 29 Left 1072566570 10:96621396-96621418 CCAGCATAATCTTCAGAACCCCA 0: 1
1: 0
2: 5
3: 14
4: 159
Right 1072566577 10:96621448-96621470 AATGATCTCAGACACCTTGATGG 0: 1
1: 4
2: 16
3: 36
4: 180
1072566570_1072566578 30 Left 1072566570 10:96621396-96621418 CCAGCATAATCTTCAGAACCCCA 0: 1
1: 0
2: 5
3: 14
4: 159
Right 1072566578 10:96621449-96621471 ATGATCTCAGACACCTTGATGGG 0: 1
1: 5
2: 17
3: 24
4: 143
1072566570_1072566574 -2 Left 1072566570 10:96621396-96621418 CCAGCATAATCTTCAGAACCCCA 0: 1
1: 0
2: 5
3: 14
4: 159
Right 1072566574 10:96621417-96621439 CATTCTTGAGAGACGACTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072566570 Original CRISPR TGGGGTTCTGAAGATTATGC TGG (reversed) Intronic
901959269 1:12811395-12811417 TGGGGTCCTGAGGATGGTGCAGG + Intergenic
901974524 1:12933525-12933547 TGGGGTCCTGAGGATGGTGCAGG + Intronic
902010648 1:13268242-13268264 TGGGGTCCTGAGGATGGTGCAGG - Intergenic
902560735 1:17275929-17275951 GGTGGTTCTGAAGATTTTCCTGG + Intronic
902924554 1:19687633-19687655 TGTGGGTCTGAAGTTTCTGCTGG - Intronic
903772675 1:25773858-25773880 TGGGGTTTTGAAGAATTTTCTGG + Intronic
904838281 1:33353834-33353856 TGGGGTTCAGGAGACTCTGCTGG - Intronic
906949934 1:50326443-50326465 GGAGGTTTTGAAGATTATGCCGG + Intergenic
908431802 1:64065868-64065890 AGTGGTTCTGAAGATTAGTCTGG + Intronic
909502755 1:76353860-76353882 TGGGGTTCTGAAGGTAAAGGGGG - Intronic
912642158 1:111357431-111357453 TGCTGTTCTGAAGAAGATGCAGG - Intergenic
916523014 1:165581908-165581930 CTAGGTTTTGAAGATTATGCCGG + Intergenic
917401280 1:174652619-174652641 TGCTGTTCTGAAGCCTATGCTGG - Intronic
919548117 1:198949236-198949258 CAAGGTTTTGAAGATTATGCCGG + Intergenic
921213066 1:212916342-212916364 TGGGGTACTGGAGATCATGCTGG - Intergenic
921308112 1:213817199-213817221 TGGGGTTTGGAAGACTAAGCTGG - Intergenic
922866178 1:228863282-228863304 TGGAGTCCTGAAGAATTTGCTGG - Intergenic
1063175890 10:3550724-3550746 TTGGGTTATGATCATTATGCTGG + Intergenic
1063287532 10:4706838-4706860 TGGGATTCTGAAAAATAAGCTGG + Intergenic
1064468190 10:15606876-15606898 AGGTGTTCTGAAGTTCATGCAGG - Intronic
1066180249 10:32955282-32955304 TGGAATCCTGGAGATTATGCCGG - Intronic
1066526462 10:36284381-36284403 TGGTGTTTTGGAGATAATGCAGG + Intergenic
1067055482 10:43047437-43047459 AGGGGTTCTGATGATTATCATGG - Intergenic
1067878775 10:50025992-50026014 TGGGGTTCTCATGAGAATGCTGG - Intergenic
1068340948 10:55701875-55701897 TAGAGTTCTGAACATTATGAAGG + Intergenic
1070878245 10:79836148-79836170 TGAGGTTCTGACAATTATGAGGG - Intergenic
1071644794 10:87352474-87352496 TGAGGTTCTGACAATTATGAGGG - Intergenic
1072566570 10:96621396-96621418 TGGGGTTCTGAAGATTATGCTGG - Intronic
1075041605 10:119112035-119112057 AGGGCTACTAAAGATTATGCTGG - Intronic
1075933723 10:126322294-126322316 TGGGGTTCTGCAGATTTTTCTGG - Intronic
1077894096 11:6440910-6440932 TGGGGTTGTGGAGCCTATGCTGG - Exonic
1078017884 11:7630771-7630793 TGTGATTCTGAAGATTCTTCAGG - Intronic
1078352392 11:10604922-10604944 AGGGGTTTTGGAGATTTTGCAGG + Intronic
1078630705 11:13001290-13001312 AGGGGTTGTGAAGATTAAGGAGG - Intergenic
1079699046 11:23520633-23520655 TGAAGTTTTGAAGATTATGCTGG + Intergenic
1085727338 11:78965614-78965636 AGGGCTTCTGAAGTTTATGACGG - Intronic
1089594334 11:119567661-119567683 TGGGGTTTTGAAAATTAGGTGGG + Intergenic
1089709504 11:120305051-120305073 TGGGGTTCTAAAGAGGATCCTGG - Exonic
1092762901 12:11825571-11825593 TAAGGATCTCAAGATTATGCAGG - Intronic
1097689536 12:62721521-62721543 AGGGGCTCTGAAAATTCTGCTGG + Intronic
1099657228 12:85508991-85509013 GGGAGTTCTGAAGATGAAGCCGG + Intergenic
1100137633 12:91573139-91573161 TGGGGTACAGAGGATTATTCTGG + Intergenic
1102012717 12:109628533-109628555 TGGGGCTCTGGAGATTCTGCAGG - Intergenic
1103081263 12:118025807-118025829 TAGGGCTCTGAACATTTTGCAGG + Exonic
1108417518 13:50213569-50213591 TTAGGTTCTGAGGAATATGCTGG - Intronic
1112345231 13:98583670-98583692 TGGGGTTCTGGGGAATATCCTGG + Intergenic
1113974060 13:114213273-114213295 TGTGGTTCTGGAGTTTGTGCAGG - Intergenic
1116244246 14:42388327-42388349 TAGGCTTCTAAATATTATGCAGG + Intergenic
1116250204 14:42472465-42472487 TGGGTTTCTGATAATTATGGAGG + Intergenic
1116814056 14:49567244-49567266 TGGGGGCCTGAAGAGTATGTTGG - Intergenic
1119403181 14:74378271-74378293 CGAGGTTTTGAAGATTATGCCGG - Intergenic
1122912235 14:104836542-104836564 TGAGGTTTTGAAGATTATGCTGG - Intergenic
1131010399 15:89012700-89012722 TGGGGTTGGGAAGATGAAGCAGG + Intergenic
1131938493 15:97534392-97534414 AGGGGTTGTGAAGATAATGAAGG + Intergenic
1133581247 16:7146604-7146626 TGGAGTGCTGAAGAATATGCTGG - Intronic
1135705525 16:24671410-24671432 TGGGGTGCTGAAGATGCTGGTGG + Intergenic
1135761133 16:25138879-25138901 TGGGGTTGTGAAGATTAATGAGG - Intronic
1136993774 16:35173735-35173757 CGGGGTTAGGGAGATTATGCGGG + Intergenic
1138411724 16:56845716-56845738 TGGGGATCTTAACATTCTGCTGG - Intronic
1138852944 16:60651998-60652020 TCGGGTTCTTAAGATTTTTCTGG - Intergenic
1139750875 16:69108098-69108120 TGGGGTTCTCTAGATCAGGCAGG + Intronic
1143490775 17:7284133-7284155 TGGGGCTCTGGAGAATATGGTGG + Intronic
1144766659 17:17736855-17736877 TGTGTTTTTGAAGATGATGCTGG + Intronic
1144779552 17:17800959-17800981 TGGGGTTCTGTGGATCATGTGGG + Intronic
1147922088 17:43923925-43923947 GGGGGTTCTGAAGACTGAGCAGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148031365 17:44623435-44623457 AGGTGTTCAGAAGATGATGCAGG + Intergenic
1148377268 17:47159741-47159763 CAAGGTTTTGAAGATTATGCCGG - Intronic
1148786262 17:50147708-50147730 TGGGGTTCTGAAGGGAATGGGGG - Intronic
1148797468 17:50203898-50203920 TGGGGTTCTGAAGGATATTTGGG + Intergenic
1149166337 17:53757537-53757559 CGAGGTTTTGAAGATTATGTCGG - Intergenic
1149866276 17:60152674-60152696 AGGGGTTTTGAAGATTGGGCTGG - Intronic
1150271753 17:63871319-63871341 TTGAGTTCTGCAGATTGTGCTGG + Intergenic
1150277432 17:63908904-63908926 TTGAGTTCTGCAGATTGTGCTGG + Intergenic
1150420448 17:65029366-65029388 TGGGGTTCTTACTATTATACAGG + Intronic
1152198802 17:78933406-78933428 TGGGGCTGTGAAGGTTGTGCCGG - Intergenic
1152791660 17:82283420-82283442 TGGGGCGCTGAAGAGCATGCAGG - Intergenic
1152926749 17:83090913-83090935 TGGGGGTCTGCAGACCATGCTGG - Intronic
1153111926 18:1601309-1601331 TGGGGTTCTGAGGGTAATACAGG + Intergenic
1159555117 18:69937818-69937840 AGGGATTCTAAAGATCATGCTGG - Intronic
1159601237 18:70430551-70430573 CGAGGTTTTGAAGATTATGCCGG + Intergenic
1160741980 19:690619-690641 CGAGGTTTTGGAGATTATGCCGG + Intronic
1163527619 19:17830963-17830985 TGGGGTTCTGAAGCTTGGGCGGG + Intronic
1164490603 19:28709660-28709682 TAGGGGTCTGAAGATGATGTTGG - Intergenic
1167160231 19:47762697-47762719 TGGGGTTGTGAAGAGCATGGTGG + Intergenic
1168364856 19:55777605-55777627 TGGGGTTTTCAAGATAATCCAGG - Intergenic
926176776 2:10600341-10600363 TGGTGTTCTTACGAGTATGCAGG - Intronic
927446236 2:23164255-23164277 TGGGGTTCTGAGCCTTTTGCCGG + Intergenic
928219286 2:29390100-29390122 TGGTGTTCTAAAGATTATAGAGG - Intronic
928307269 2:30180476-30180498 TGGGCTTCTGCAGAGTATGGTGG + Intergenic
932877207 2:75465429-75465451 TGGGGTTCTGTAGGTTGTGTAGG - Intergenic
933659531 2:84916095-84916117 TGAGGTTTTGAAGATTATGCCGG + Intergenic
934580456 2:95433853-95433875 TGGGGTAGTGAAGAGAATGCTGG + Intergenic
934598991 2:95642864-95642886 TGGGGTAGTGAAGAGAATGCTGG - Intergenic
935369934 2:102334441-102334463 TGGGCCTCTGGAGAATATGCTGG - Intronic
935429621 2:102961205-102961227 TGGGGTTTAGGAGATTAAGCAGG + Intergenic
935879844 2:107553796-107553818 TAGGCTTCTGAAGATTATTCAGG - Intergenic
937594782 2:123660176-123660198 TGGGGTTTGGGAGATTAGGCAGG + Intergenic
938308842 2:130272238-130272260 TGGGATGCTGGAGATTATGATGG - Intergenic
938446628 2:131385709-131385731 TGGGATGCTGGAGATTATGATGG + Intergenic
938717012 2:134030059-134030081 TGGGGGTCTGAAGCCCATGCTGG - Intergenic
940395738 2:153189136-153189158 TTCTGTTCTGAGGATTATGCTGG + Intergenic
942171962 2:173297945-173297967 CGAGGTTTTGAAAATTATGCTGG + Intergenic
944627355 2:201584876-201584898 TGGGTTTCTGTATATTATGTTGG - Intronic
946766633 2:223046643-223046665 TTGGGATCTGAAGATTGAGCAGG - Intergenic
947044588 2:225967085-225967107 TGGATTTCTGAAGGTAATGCGGG - Intergenic
947129091 2:226903507-226903529 TGGGGGTCTGCAGATAATGGGGG + Intronic
949063705 2:241976258-241976280 AAGGGTTATGAAGATTGTGCAGG + Intergenic
1170394374 20:15909857-15909879 TGGGGTTCAGAAGAAAATACTGG + Intronic
1172336726 20:34122723-34122745 AGAGGGTTTGAAGATTATGCCGG + Intergenic
1175956128 20:62610324-62610346 TGGGGTCCTGATGATTCTGGGGG - Intergenic
1179526528 21:41980651-41980673 TGGGGTTCTAAAGTTTCTGTTGG - Intergenic
1181849038 22:25736653-25736675 TGGGGTTGTGAAGATTTGGAGGG - Intergenic
1184659499 22:45959391-45959413 TGGGGTGGTGAGGATTATGAGGG + Intronic
949871115 3:8589960-8589982 TGGGATTTTGGAGATTATTCAGG - Intergenic
953931064 3:47005882-47005904 CGGGGTTCTGAAGATCATGGGGG + Intronic
956173061 3:66448069-66448091 TTGTGTTCTGAGGATAATGCCGG - Intronic
956999282 3:74866480-74866502 TGATGTTCTGAAAATTATGATGG - Intergenic
957858604 3:85913177-85913199 AAGGATTCTGAAGATTATGGAGG + Intronic
961360492 3:126364338-126364360 AGGGGATCTGCAGATGATGCAGG - Intergenic
964894860 3:161583485-161583507 AGGTGTTCTGATGATCATGCAGG + Intergenic
966516653 3:180828303-180828325 TGGAGTTCTGAAGACTTTCCTGG - Intronic
971481846 4:27122018-27122040 TGAGGATCTGAAGAGGATGCTGG + Intergenic
972045786 4:34663645-34663667 TGGGGTTGTGTGGATTATCCTGG + Intergenic
972879956 4:43410590-43410612 TGAGGTTTTGAAGATTATGCCGG - Intergenic
974741474 4:66013476-66013498 TGGAGTTCAGAAGATTATTGGGG - Intergenic
974886671 4:67827260-67827282 TGGGGCGCTCAAGAATATGCTGG - Exonic
979663676 4:123287386-123287408 TGTGGTTCTGAAGTTTGTGGGGG + Intronic
980595788 4:134952735-134952757 CGAGGTTTTGAAGATAATGCCGG - Intergenic
982912426 4:161161193-161161215 CAGAGTTCTGAAGAATATGCAGG + Intergenic
986803355 5:11284230-11284252 TGGGGAGGTGAAGGTTATGCAGG + Intronic
987883430 5:23780523-23780545 TTGGGGTGTGAAGATTATCCAGG - Intergenic
988673500 5:33407329-33407351 TGGGGTTCTGAAAATAAGGGAGG + Intergenic
990296799 5:54410037-54410059 TGGGCTCCTGAATTTTATGCTGG - Intergenic
990361986 5:55029902-55029924 TGGGGTTCTGGAGATGATAGTGG + Intronic
991954893 5:71984841-71984863 TGGGGTTCTGTTGATTATGATGG - Intergenic
998303550 5:141050977-141050999 TGGGCTTCGGAAGACTCTGCAGG + Intergenic
998461964 5:142316490-142316512 TGGGGTTCTTAAGATTGGGGTGG - Intronic
1000641978 5:163713532-163713554 TGGGGTTCTGACTTTTATGAGGG - Intergenic
1002039311 5:176500477-176500499 TGGGATTCTGAAGCCAATGCAGG - Intronic
1002056796 5:176602693-176602715 TGGGGTCCTGAAGATGGTCCTGG + Intronic
1004238510 6:13897272-13897294 TGTTGTTCTGAAGATTAAACAGG - Intergenic
1006336507 6:33423821-33423843 TGTGGTTCTGAAGATTTCGGGGG + Intronic
1007016839 6:38477040-38477062 TGGGGTTCTGAAGATTAATAAGG + Intronic
1009747057 6:67830163-67830185 TGAGGATCTGAACATTCTGCAGG - Intergenic
1010462535 6:76129712-76129734 TGAGGTTCTGTTGATTATGAAGG + Intergenic
1016314276 6:142769821-142769843 TGGGGAACTGAAGAATCTGCTGG + Exonic
1016986413 6:149898995-149899017 TGAGGTTCTGAAGATCACTCTGG - Intergenic
1018140588 6:160830045-160830067 TGGGCTTGTGAAGATTGTGTTGG + Intergenic
1018367550 6:163137464-163137486 TGGAGTTCTGAGGATTTTGGTGG - Intronic
1018730925 6:166649901-166649923 TGCAGTTCTGAAGTTTCTGCTGG - Intronic
1019054787 6:169215205-169215227 GGGATTTCTGAATATTATGCAGG - Intergenic
1023753383 7:43393052-43393074 TGGGGTGTAGAAGATTCTGCAGG - Intronic
1028405503 7:90469627-90469649 TAAGGTTCTGCTGATTATGCTGG + Intronic
1031592335 7:123609150-123609172 TGGGGTTCTGAGGGAGATGCAGG - Intronic
1031665781 7:124480828-124480850 CGAGGTTTTGAAGATTATGCCGG + Intergenic
1031773816 7:125881301-125881323 TGGGACTCTGAAAATTATGTAGG - Intergenic
1032220496 7:129990622-129990644 TGAGGTGCTGAAAATTCTGCTGG + Intergenic
1033803254 7:144925985-144926007 TGGGCTTCTGAATCTTTTGCAGG + Intergenic
1034324524 7:150218802-150218824 TGGAGTTCAGAAGATCATTCAGG - Intergenic
1034768669 7:153750429-153750451 TGGAGTTCAGAAGATCATTCAGG + Intergenic
1038865375 8:31433909-31433931 TGTGGTTCTGAAAGTGATGCTGG + Intergenic
1043702316 8:83304659-83304681 TGGGGATGTGAAGATAAAGCAGG - Intergenic
1044971515 8:97624750-97624772 TGAGGTTTTGAAGATTATGCTGG - Intergenic
1046461988 8:114551327-114551349 TAGGGATATGAAGATTATACAGG - Intergenic
1046531976 8:115457996-115458018 TGAGGTTCTGATGACTAAGCAGG + Intronic
1055993337 9:82131075-82131097 TGAGGTTTTGAAGATTATGCTGG + Intergenic
1056073673 9:83015942-83015964 TGGGGTTTTGAAGGTTAAGAGGG - Intronic
1056883877 9:90421189-90421211 TGGGGTTCTGATGGCTATACAGG - Intergenic
1059332982 9:113548212-113548234 GGGACTTCTGAAGATTCTGCTGG + Intronic
1062072188 9:134562224-134562246 TGGGGTTCTGAGGACAGTGCTGG - Intergenic
1062416479 9:136453619-136453641 TTGGTTTCTGCAGATCATGCTGG - Intronic
1186317664 X:8388107-8388129 TGGGGTTCTGCAGGCTATACAGG - Intergenic
1189129180 X:38480559-38480581 CTGGGTTCTGAAGATTTTACTGG - Intronic
1189960175 X:46316824-46316846 TAGGGTTGTGAGGATTAAGCAGG + Intergenic
1190003254 X:46709795-46709817 TGGGGTTCTCAAGGTTCTCCGGG + Intronic
1193652618 X:84156671-84156693 TGGGGCTCTGCAGATTTTGTTGG - Intronic
1198983293 X:142423841-142423863 TGGGGTGGTGAAGATTTTGGGGG + Intergenic
1199145476 X:144361077-144361099 TGGAGTTCTGAATATTATAGAGG + Intergenic