ID: 1072569573

View in Genome Browser
Species Human (GRCh38)
Location 10:96646783-96646805
Sequence CTTCACAATCACATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072569573_1072569580 21 Left 1072569573 10:96646783-96646805 CCTGCCTCCATGTGATTGTGAAG 0: 1
1: 0
2: 2
3: 13
4: 223
Right 1072569580 10:96646827-96646849 AACCTCTGCACAACTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072569573 Original CRISPR CTTCACAATCACATGGAGGC AGG (reversed) Intronic
901645984 1:10716985-10717007 CTTCACCAGCACAGGCAGGCGGG + Intronic
902463023 1:16593477-16593499 CTTCACTACCACATGAATGCTGG - Exonic
903158495 1:21467250-21467272 CTTCACTACCACATGAATGCTGG + Intronic
903377265 1:22874647-22874669 CGTCACAATCAGATGGAGTAGGG - Intronic
906372302 1:45264535-45264557 CTCCACAACAACATGAAGGCTGG + Intronic
906840930 1:49138497-49138519 TTTCTCCATCACATGGAGTCTGG + Intronic
907326351 1:53640982-53641004 CTTCAAAAGCACAGGGAGACAGG + Intronic
907673475 1:56497390-56497412 CATCATAAGCACATTGAGGCAGG - Intronic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
912237806 1:107870876-107870898 CTTCACACTCACCCAGAGGCAGG + Intronic
915732856 1:158066611-158066633 CTACAGGAGCACATGGAGGCAGG - Intronic
917166674 1:172120222-172120244 GTTCAAAGTCACATGGTGGCAGG + Intronic
921082001 1:211748386-211748408 CTTCAAAAGCAACTGGAGGCCGG + Exonic
1062896959 10:1110722-1110744 CCTCAGAATGACATGGTGGCAGG - Intronic
1063347402 10:5324866-5324888 CTTCCCACCCACATGCAGGCTGG - Intergenic
1063365413 10:5487420-5487442 CCTCACAACCACGTTGAGGCGGG + Intergenic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1066985992 10:42466854-42466876 CTACATCCTCACATGGAGGCAGG + Intergenic
1069457843 10:68567906-68567928 CTACACCATGAGATGGAGGCTGG + Intronic
1070283016 10:75063570-75063592 CTGCACAGTCTCCTGGAGGCTGG + Intergenic
1071839186 10:89451345-89451367 CTACACAGTCACATAGAGCCTGG + Intronic
1072569573 10:96646783-96646805 CTTCACAATCACATGGAGGCAGG - Intronic
1072749142 10:97964256-97964278 CATCAGAATCACATGGTGGGGGG + Intronic
1074140263 10:110666344-110666366 CTTAAAAATCACCTGGGGGCTGG + Intronic
1074185454 10:111096728-111096750 CCTCAGGATCTCATGGAGGCAGG + Intergenic
1076336394 10:129709630-129709652 CTGCATAATCATATGGAGGCTGG + Intronic
1078246359 11:9575176-9575198 GTTCCTAATCACACGGAGGCCGG - Intronic
1079410245 11:20180762-20180784 CATCAGCATCACTTGGAGGCTGG - Intergenic
1081480130 11:43478499-43478521 CTTCACATTAACATGGATGAGGG + Intronic
1083601605 11:63952149-63952171 CCTCAGAATCACAGGGAGGAAGG - Intronic
1084566031 11:69929596-69929618 TGTCACAATCCAATGGAGGCAGG - Intergenic
1084643625 11:70441383-70441405 AATCAAAACCACATGGAGGCTGG + Intergenic
1085409255 11:76281803-76281825 CTCCAGAGTCACAAGGAGGCAGG - Intergenic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1085975018 11:81642339-81642361 CCTCACAATGACATGGGAGCTGG + Intergenic
1088910518 11:114187626-114187648 CTTAACACTCACAGTGAGGCAGG + Intronic
1091347388 11:134864458-134864480 CTGCACGTTCACCTGGAGGCAGG + Intergenic
1092379993 12:7987935-7987957 ATTCACAAAGAAATGGAGGCTGG - Intergenic
1093118868 12:15244046-15244068 CTACACTATCACACAGAGGCTGG + Intronic
1094475775 12:30839622-30839644 GTTCTAAATCACATGGGGGCAGG + Intergenic
1096071218 12:48776440-48776462 CTGGCCAACCACATGGAGGCAGG - Exonic
1098352122 12:69573757-69573779 CTTCAAAATAACACGCAGGCTGG - Intronic
1098461305 12:70735788-70735810 CTTCACAACATCCTGGAGGCAGG - Intronic
1099716016 12:86295026-86295048 CATCACAATTACATGGAGAATGG + Intronic
1102234483 12:111285731-111285753 CTTCACCACAACACGGAGGCAGG - Intronic
1102401223 12:112631271-112631293 TTTCACAGTGAAATGGAGGCAGG + Intronic
1102563457 12:113779106-113779128 ATTAACAACCCCATGGAGGCAGG + Intergenic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1104217373 12:126747419-126747441 CTTCAGAATCAATTGGAGGAAGG + Intergenic
1105045435 12:132999549-132999571 CTTTAAAAACACATGGCGGCTGG - Intronic
1111986164 13:95068977-95068999 CTTCACACTCACAAGGATGCTGG + Intronic
1112581056 13:100676272-100676294 CTTCACTATCACAGGGAGACAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114711315 14:24781241-24781263 CTGCAAAGTCCCATGGAGGCTGG - Intergenic
1118719683 14:68585314-68585336 CTTCACCATGGCAGGGAGGCCGG + Intronic
1120701393 14:87703224-87703246 TGTCAGAATCACATAGAGGCAGG - Intergenic
1121493797 14:94378348-94378370 ATTTACAGTCACATGCAGGCAGG + Exonic
1121734589 14:96209106-96209128 CTTTAGAATCACCTGGAGACTGG + Intronic
1122283195 14:100636298-100636320 CTTCCCACTCACATCCAGGCAGG + Intergenic
1123629760 15:22253540-22253562 CTTCTCAATCACAGGAAAGCAGG + Intergenic
1124647622 15:31450096-31450118 CTTAATAATCAAGTGGAGGCGGG - Intergenic
1127312795 15:57767441-57767463 CTGTACAATCACTTGGGGGCGGG + Intronic
1127574466 15:60277142-60277164 CTTTACAACAACATGGATGCAGG + Intergenic
1129028062 15:72597781-72597803 TTTCACAACCCCTTGGAGGCTGG - Exonic
1130438496 15:83926549-83926571 TTGCAGATTCACATGGAGGCAGG - Intronic
1130677565 15:85967194-85967216 CCTCACAAACACATGGAGTAGGG - Intergenic
1131922707 15:97347380-97347402 CTTCAAAATCAGATTGAGACTGG - Intergenic
1132869725 16:2110532-2110554 CTTCACCGTCACATTGAGCCAGG + Exonic
1133187813 16:4113051-4113073 CTTCCAAATCACCTGGTGGCTGG + Intronic
1134455397 16:14391622-14391644 CTTCACAGTCACATGGAATAGGG - Intergenic
1134717695 16:16365069-16365091 CTTCACCGTCACATTGAGCCAGG - Intergenic
1134957057 16:18387090-18387112 CTTCACCGTCACATTGAGCCAGG + Intergenic
1136147469 16:28323727-28323749 ATTTACAAACACATGGAGGAAGG - Exonic
1137343220 16:47630627-47630649 ATTAACAATCACATGGGTGCAGG - Intronic
1139211937 16:65086633-65086655 CTTCACAGTCACCTGGAAGCTGG + Intronic
1146236284 17:31166799-31166821 CTTAACATCCACATGGAGACTGG - Intronic
1147197792 17:38779294-38779316 CTTCCCAATTACATGGAAGTTGG + Intronic
1147906467 17:43826373-43826395 CATCAGCATCACCTGGAGGCAGG + Intronic
1148541542 17:48484383-48484405 CTTCAAAATCTGATGGGGGCTGG + Intergenic
1148879987 17:50718374-50718396 CTTCACAATAGCATCGTGGCTGG + Intergenic
1149855857 17:60082023-60082045 CTTCACAATCACAGCCAGCCTGG - Intergenic
1151134809 17:71936115-71936137 CTTGACAATCACTTGAAGGCTGG - Intergenic
1152358924 17:79821162-79821184 CTTGACAATCATGTGGACGCTGG + Intergenic
1154291946 18:13116036-13116058 CTTCACTATCACAGGGACACAGG - Intronic
1155097154 18:22567929-22567951 CTTGACAAATACATGGAGTCAGG + Intergenic
1155233917 18:23800031-23800053 CTTCACAGTGACATTTAGGCTGG + Intronic
1156069857 18:33193937-33193959 CTGCATCATCACATGGAGGAAGG + Intronic
1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG + Intergenic
1160406085 18:78647181-78647203 CTACACCATCACAGAGAGGCCGG + Intergenic
1160609874 18:80076614-80076636 AGTCACAGTCACATGAAGGCCGG - Intronic
1161085084 19:2331271-2331293 TTTCACAGTCACTTGGAAGCGGG + Intronic
1163002753 19:14379024-14379046 CTGCAGAATCTCAGGGAGGCAGG - Intergenic
1163286260 19:16350123-16350145 TTTAAAAATCAGATGGAGGCTGG + Intergenic
1163988066 19:20971350-20971372 TGTCACAATTACCTGGAGGCAGG - Intergenic
1164259270 19:23554976-23554998 CTTTTTAATCACCTGGAGGCAGG - Intronic
1168683596 19:58334712-58334734 CTTCAGCATCACATGGAACCTGG - Intronic
1202678684 1_KI270711v1_random:30909-30931 CTTCACTACCACATGAATGCTGG - Intergenic
926122386 2:10251236-10251258 CATCAGAATCACCTGGAGGGAGG + Intergenic
926326088 2:11785968-11785990 CTTCAGAAACACAGTGAGGCTGG - Intronic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
927678033 2:25121346-25121368 CTGCACAAACACACGGGGGCGGG - Intronic
928053421 2:28025698-28025720 CATCATAACAACATGGAGGCTGG - Intronic
928721408 2:34125653-34125675 GTGCCCAATCACATGGAGGGTGG - Intergenic
930126784 2:47804781-47804803 TTTCACAATCACATGTACGTTGG - Intronic
933708789 2:85310159-85310181 CTTCACAATCCCAGAGTGGCAGG + Exonic
933916004 2:86994211-86994233 CTTCAGAATCACCTGGAGTAAGG + Intronic
934006989 2:87775691-87775713 CTTCAGAATCACCTGGAGTAAGG - Intronic
935770632 2:106416597-106416619 CTTCAGAATCACCTGGAGTAAGG - Intronic
935909454 2:107879338-107879360 CTTCAGAATCACCTGGAGTAAGG + Intronic
935967585 2:108496340-108496362 CTTCAGAATCACCTGGAGTAAGG + Intronic
936131231 2:109844474-109844496 CTTCAGAATCACCTGGAGTAAGG + Intronic
936213466 2:110527011-110527033 CTTCAGAATCACCTGGAGTAAGG - Intronic
936288298 2:111198697-111198719 CTTCACAGAAACATGGAGACTGG + Intergenic
936422604 2:112381570-112381592 CTTCAGAATCACCTGGAGTAAGG - Intronic
938713393 2:133995318-133995340 CTTCAAAATCACAATGAGGTAGG + Intergenic
939959576 2:148554436-148554458 CATCAGAATCACTTGGAGGAGGG - Intergenic
940087039 2:149871812-149871834 CTTCACAATGACCTGGTGGTAGG + Intergenic
940518985 2:154718565-154718587 CTTCTCAATTAAATTGAGGCAGG - Intronic
940883947 2:158972540-158972562 CTTGACACTCATCTGGAGGCTGG + Intronic
940968191 2:159863740-159863762 CTACACAAGCATATGGAGGCAGG - Intronic
942971536 2:181962825-181962847 CTTCACATCCACATGAAGACAGG + Intronic
943369803 2:187002504-187002526 CATCCCAATCACCTGGAGGTGGG + Intergenic
944548426 2:200821772-200821794 CTTCAAAGTTACATGGAGGCTGG + Intronic
946040394 2:216778224-216778246 CTTCCCCGTAACATGGAGGCTGG + Intergenic
946105539 2:217366266-217366288 CTTCACTAACTCATGAAGGCAGG + Intronic
948119681 2:235520076-235520098 CTTCAAAATAATATTGAGGCCGG - Intronic
948632400 2:239310523-239310545 CTACGCAGTCTCATGGAGGCAGG - Intronic
948688138 2:239684288-239684310 CTTCACAACCACACGCTGGCTGG + Intergenic
1169873320 20:10270378-10270400 CTTCAGCATCACCTGAAGGCTGG + Intronic
1173606900 20:44337932-44337954 CTCCACAAGCCCCTGGAGGCAGG + Intronic
1174333334 20:49838683-49838705 CTTCACTTTCCCATGGAGGAAGG - Intronic
1175737684 20:61398704-61398726 CTTCACCACCACATTCAGGCTGG + Intronic
1176624849 21:9083779-9083801 CTCCGCATTCACATGGACGCGGG + Intergenic
1178241954 21:30912960-30912982 CTTAACAGCCACAGGGAGGCTGG + Intergenic
1178254477 21:31039313-31039335 CTCCACAGTCACAGGTAGGCAGG + Intergenic
1178267093 21:31153760-31153782 CTTAAAAATCACAAGAAGGCTGG + Intronic
1178355973 21:31911033-31911055 CTGTACAATCACATTGGGGCTGG + Intronic
1178664549 21:34534872-34534894 CCGCACCATCACATGGAGACTGG + Intronic
1178722736 21:35024324-35024346 CTTCACAATCACAAAGAACCAGG - Intronic
1178762815 21:35420280-35420302 CTTCACAGTAACATGTAGACTGG + Intronic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
1182678244 22:32057220-32057242 CTTCACAATCAGAGGCAGCCAGG - Intronic
1183751515 22:39723670-39723692 CTCCATCATCACATGGGGGCTGG - Intergenic
1184350508 22:43940511-43940533 ATTTAAAATCACATGAAGGCCGG + Intronic
1184439709 22:44501701-44501723 CTTCTAAATCAGATGGGGGCAGG + Intergenic
1184443365 22:44532701-44532723 CTTCACAATAACAAGAACGCAGG - Intergenic
1184764047 22:46562296-46562318 CTTCACCCTCACAGGGATGCTGG - Intergenic
950391403 3:12699617-12699639 CATCAAAATCACATGGGGGCTGG - Intergenic
953212590 3:40889308-40889330 CATCAGCATCACATGGAAGCTGG - Intergenic
955019910 3:55109949-55109971 CTTTGCCATCACATGGAGTCAGG - Intergenic
955335693 3:58083857-58083879 ATTCACAGTCACTTGAAGGCTGG + Intronic
958425188 3:93971467-93971489 ATTTAAAATCATATGGAGGCTGG + Intronic
958634089 3:96720365-96720387 GTTCACAATCAGATGGAAACAGG + Intergenic
959585315 3:108020246-108020268 CTGAACAAACACATGGGGGCAGG + Intergenic
960993878 3:123328656-123328678 CTAGCCAACCACATGGAGGCTGG - Exonic
965678265 3:171222713-171222735 CTTCAGAAAGAGATGGAGGCTGG + Intronic
967017296 3:185493835-185493857 ATTAAAAATCACTTGGAGGCCGG - Intronic
970026161 4:11626219-11626241 CATCAAAATCACCTGGATGCTGG + Intergenic
971871790 4:32250335-32250357 CTTAAAAATCACATGCTGGCTGG - Intergenic
974870134 4:67632322-67632344 CTTCAAAATCACCTGGGGGAAGG + Intronic
977088481 4:92636530-92636552 TTTCACAGTCACATGGTGGTAGG + Intronic
978223122 4:106301747-106301769 CTTAACAATAACATGCAGGGTGG + Intronic
978712570 4:111802696-111802718 CTTCACATTCACAGGGCGGCAGG + Intergenic
980597709 4:134976194-134976216 CTTCAGAATCAAATTGGGGCCGG + Intergenic
982676019 4:158376696-158376718 CTGCATCATCACATGGAGGAAGG + Intronic
986146670 5:5084294-5084316 TCTCAGAATCACATGGATGCAGG - Intergenic
987579996 5:19777523-19777545 CTTCACAAGCACAGTGTGGCCGG - Intronic
987745571 5:21967430-21967452 GTTTACAACCACTTGGAGGCTGG + Intronic
989204223 5:38795685-38795707 CTTCACAAGCACTTTGGGGCAGG + Intergenic
989312745 5:40039448-40039470 CTGCACCATCACATGGTGGAAGG + Intergenic
991765772 5:69977558-69977580 GTTTACAACCACTTGGAGGCTGG + Intergenic
991781550 5:70140604-70140626 GTTTACAACCACTTGGAGGCTGG - Intergenic
991845007 5:70852629-70852651 GTTTACAACCACTTGGAGGCTGG + Intergenic
991873993 5:71140918-71140940 GTTTACAACCACTTGGAGGCTGG - Intergenic
994913875 5:105947458-105947480 ATTCAGAATTACATGGAGTCTGG - Intergenic
994957052 5:106545689-106545711 CTTCAACATCACAGAGAGGCTGG + Intergenic
996371474 5:122757698-122757720 CTTCACAATTGCATGAAGACAGG - Intergenic
996425195 5:123306391-123306413 CTTCACAATGACATGTAGGCTGG - Intergenic
996841685 5:127853474-127853496 CATCAAAAGCACCTGGAGGCTGG + Intergenic
997386691 5:133479192-133479214 CATGACAATCCCATGAAGGCGGG + Intronic
997553001 5:134769955-134769977 ATTAACAAACACCTGGAGGCTGG - Intronic
998812446 5:145979658-145979680 TTTCACAAGCCCATGGAAGCTGG + Intronic
1000827284 5:166060617-166060639 CTGCATCATCACATGGAGGAAGG - Intergenic
1000895037 5:166845277-166845299 CTTTCCTATCACTTGGAGGCGGG + Intergenic
1002107274 5:176886283-176886305 GGTGAAAATCACATGGAGGCTGG + Intronic
1003250952 6:4428858-4428880 CATCAGAATCCCCTGGAGGCTGG - Intergenic
1004852802 6:19717632-19717654 CTTAAAAATCACATTGGGGCCGG + Intergenic
1005765774 6:29010668-29010690 ATTGACAATCACCTGGAGTCCGG - Intergenic
1007485427 6:42177942-42177964 CTTGACAATCACAGGGAAGCAGG + Intronic
1007560915 6:42807477-42807499 CTTCAAAATAATATGAAGGCCGG - Intronic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1010003476 6:70971266-70971288 CATCAGAATCACCTGGAGGGAGG + Intergenic
1010038203 6:71351076-71351098 CTTTACATTTACATGGAGGCAGG - Intergenic
1012972698 6:105748744-105748766 CTTCTCCATCTCCTGGAGGCTGG + Intergenic
1013053903 6:106564532-106564554 CATCAGAATCACCTGGAGGGCGG + Intronic
1017048141 6:150366199-150366221 CTGCACATGCTCATGGAGGCAGG - Intergenic
1018407844 6:163506068-163506090 CTTCACAAGGTGATGGAGGCGGG - Intronic
1020863617 7:13526734-13526756 CATCAGAATCACATGGAGGCTGG - Intergenic
1023406078 7:39834450-39834472 CTACACAATGACCTGGCGGCAGG + Intergenic
1023635356 7:42204117-42204139 CTTCCCACTCACATGAAGGATGG + Intronic
1024432410 7:49303999-49304021 CTTAAAATTCATATGGAGGCTGG - Intergenic
1024853904 7:53754478-53754500 CTTAACAAAGCCATGGAGGCAGG + Intergenic
1027602747 7:80259646-80259668 CTTCAAAGTCAAATGGAGACAGG + Intergenic
1032205039 7:129856093-129856115 CGGCACAATCAGGTGGAGGCAGG + Intronic
1032899991 7:136296160-136296182 CTGCAGAATAACATGGATGCAGG + Intergenic
1034148700 7:148895883-148895905 TTTTAAAATCACACGGAGGCTGG - Intergenic
1034149604 7:148904024-148904046 CTTCTCAATCTAATGGAAGCAGG + Intergenic
1034286974 7:149891523-149891545 CTTAACAATGACACGGAGGCAGG + Intergenic
1034664146 7:152801377-152801399 CTTAACAATGACACGGAGGCAGG - Intronic
1035755389 8:2027146-2027168 CTTCACCATGACCTGGGGGCGGG + Intergenic
1037635902 8:20700881-20700903 CTTCCCAGCCACATGGAGGATGG - Intergenic
1037677912 8:21067754-21067776 CTTAACAATCAGATGGAGTTTGG + Intergenic
1039797255 8:40925884-40925906 ATTTACCATCACATGCAGGCAGG - Intergenic
1039994987 8:42524325-42524347 CTTCAAAATAACATGGTGGTGGG + Intronic
1040440276 8:47434314-47434336 CTGCACACTCACATGCATGCTGG + Intronic
1041020805 8:53636307-53636329 CTTCACAGCAACATGTAGGCTGG + Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1045195248 8:99923954-99923976 GTTTAAAATCACAAGGAGGCTGG - Intergenic
1045313241 8:101021886-101021908 CTCCACAGCCACATGGATGCTGG + Intergenic
1048950438 8:139492241-139492263 CATCAGAATCACCTGGAGGTGGG + Intergenic
1049270512 8:141693240-141693262 CATCACAATCGCCTGGAGGTTGG - Intergenic
1050450234 9:5772899-5772921 CTACACATTTTCATGGAGGCAGG + Exonic
1052603849 9:30672505-30672527 CCTGACAATCACATGGGGACTGG + Intergenic
1058189066 9:101891159-101891181 CTTCTCACTCACATGGATGAGGG - Intergenic
1058430545 9:104914684-104914706 CTCCACAATCACATGTAGAATGG + Intronic
1060250855 9:121985928-121985950 CTTCACAATAAAAGGCAGGCAGG + Intronic
1062261884 9:135666919-135666941 ATTCACCAAAACATGGAGGCGGG - Intergenic
1062364169 9:136201153-136201175 CTTCACCATCACCTGGAGCTGGG + Intronic
1062630127 9:137459608-137459630 CTGCAGGATCACAGGGAGGCCGG + Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1189361966 X:40359822-40359844 CCTCCCAATCACCTGGAGGTGGG + Intergenic
1189649651 X:43175822-43175844 CTGCACCATCACATGGAAGAAGG + Intergenic
1192239160 X:69315641-69315663 TTTCATAATAAGATGGAGGCGGG - Intergenic
1196164411 X:112522705-112522727 CTGAACAACCACATGCAGGCAGG + Intergenic
1196667312 X:118330198-118330220 TTTCACAGTCACTTGGAGGAAGG + Intergenic
1197128484 X:122975812-122975834 CTTCAAAATCATATGAGGGCAGG + Intergenic
1200847646 Y:7848679-7848701 CTTGAAAACAACATGGAGGCAGG + Intergenic
1200897424 Y:8390458-8390480 TTTCACTATCACATGGATGAAGG - Intergenic
1201380555 Y:13372887-13372909 CTTCACAATCACCAGGATGAAGG + Intronic