ID: 1072570135

View in Genome Browser
Species Human (GRCh38)
Location 10:96651327-96651349
Sequence TTCGGTTAGCAGTTTATCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072570130_1072570135 6 Left 1072570130 10:96651298-96651320 CCGCTTGCAGGGATATTGTTCTT 0: 1
1: 0
2: 1
3: 41
4: 148
Right 1072570135 10:96651327-96651349 TTCGGTTAGCAGTTTATCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 90
1072570127_1072570135 21 Left 1072570127 10:96651283-96651305 CCAAAGAGGTGCAGTCCGCTTGC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1072570135 10:96651327-96651349 TTCGGTTAGCAGTTTATCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072570135 Original CRISPR TTCGGTTAGCAGTTTATCAA GGG Exonic
902899275 1:19502888-19502910 CTAGGTTAGGAGTTTTTCAAAGG - Intergenic
903054359 1:20625253-20625275 CTAGGTTAGGAGTTTTTCAAAGG + Intergenic
906388993 1:45397428-45397450 TTTGAGTAGCAGTTTCTCAAGGG - Intronic
911861041 1:102949724-102949746 AACGCTTAGCAGTTTATAAATGG + Intronic
912580702 1:110718530-110718552 TTTGGTGAGCTCTTTATCAAGGG + Intergenic
917047511 1:170878152-170878174 TTCAGTTAGAAGTTCATTAATGG + Intergenic
917657149 1:177137833-177137855 TTTAGTTAGCATTTTATTAATGG - Intronic
918882532 1:190143808-190143830 TTCAGTTAGCATTTGATAAAGGG - Intronic
924151628 1:241135662-241135684 TTTGGTTAGGGGTTTTTCAAGGG - Intronic
1067579816 10:47436211-47436233 TTTAGCTAGCAGTTTCTCAATGG + Intergenic
1072150256 10:92677016-92677038 TTCAGTTAGAAATTTATCCAGGG - Intergenic
1072570135 10:96651327-96651349 TTCGGTTAGCAGTTTATCAAGGG + Exonic
1079258310 11:18852372-18852394 TTCAGTTAGCAGGTGATGAATGG - Intergenic
1079973528 11:27064701-27064723 ATAGGTTAGGAGTTTTTCAAAGG + Intronic
1091856424 12:3744244-3744266 TTCCATTAGCAGTTTATCTGTGG + Intronic
1094219893 12:27980916-27980938 ATTTGATAGCAGTTTATCAAAGG - Intergenic
1097588613 12:61545511-61545533 GTAGGTTAGGAGTTTTTCAAAGG + Intergenic
1106590804 13:31097016-31097038 ATAGGTTAGGAGTTTTTCAAAGG + Intergenic
1107250621 13:38356771-38356793 TTCTGTTAGGAGTATATTAAAGG + Intronic
1107949019 13:45445441-45445463 GTAGGTTAGGAGTTTTTCAAAGG + Intergenic
1112959638 13:105107673-105107695 CTAGGTTAGGAGTTTTTCAAAGG + Intergenic
1114053789 14:18947514-18947536 TTCAGTTAACAGTTTGTCATTGG - Intergenic
1114108766 14:19454411-19454433 TTCAGTTAACAGTTTGTCATTGG + Intergenic
1125152771 15:36552003-36552025 TTCGTTTAACAGTTTCTTAAAGG - Intergenic
1128334333 15:66776456-66776478 GACGTTTAGCAGTTTATCGATGG + Intronic
1138916531 16:61471494-61471516 TTTAGTTAGCAGATTATGAATGG - Intergenic
1139816723 16:69680473-69680495 TTTGTTCAGCAATTTATCAAAGG - Intronic
1143432196 17:6895378-6895400 TTTGGGTACCAGTTTCTCAATGG + Intronic
1143694910 17:8606719-8606741 TTAGGTTAGCAGTTTAGAAGGGG + Intronic
1149182882 17:53961379-53961401 TTCGGAGAGCAATTTAGCAATGG + Intergenic
1155047346 18:22114367-22114389 TTCTGTTTCCAGTTCATCAACGG - Intergenic
937567847 2:123317603-123317625 TTCAGGTGGCAGTTTATCAAAGG + Intergenic
939154730 2:138511136-138511158 TCCTGTAAGCATTTTATCAATGG + Intronic
947041463 2:225925961-225925983 TTTGGTTAGCCATTTATTAAAGG + Intergenic
1169954578 20:11087109-11087131 TTCGTTTATCAGTTTACCATGGG + Intergenic
1180472260 22:15669895-15669917 TTCAGTTAACAGTTTGTCATTGG - Intergenic
1182957931 22:34444817-34444839 TTTGGGTAACAGTTCATCAAAGG - Intergenic
953471844 3:43174046-43174068 ATAGGTTAGGAGTTTTTCAAAGG - Intergenic
954343593 3:49976244-49976266 TACTATTAGCAGTTTATCATGGG + Intronic
955638973 3:61061435-61061457 TAGGGTTAGCAATTTATGAAAGG - Intronic
955861543 3:63335562-63335584 TCAGGTTAACAGTTTCTCAAAGG - Intronic
958031961 3:88122367-88122389 ATCCGTCAGCAGTTTATCATAGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960519596 3:118639621-118639643 TTCGGTTATCAGTGGGTCAATGG + Intergenic
962933007 3:140054762-140054784 TACTGTTAACTGTTTATCAAAGG + Intronic
964390494 3:156191705-156191727 TTCATTTAGCATTATATCAATGG - Intronic
965863260 3:173172559-173172581 TTCTGGTAGCATTTTGTCAATGG - Intergenic
970776244 4:19677957-19677979 TTAGGCCAGCAGTTTTTCAAAGG - Intergenic
974104906 4:57458828-57458850 TTCTGTAACCAGTTTATCATTGG - Intergenic
975791799 4:77961158-77961180 TTTGGTTGGCTTTTTATCAATGG - Intergenic
978088093 4:104679701-104679723 TTCGTTTTTCTGTTTATCAATGG + Intergenic
980515691 4:133856464-133856486 TTGGGTTAACAATTTAACAAAGG - Intergenic
983004287 4:162464888-162464910 ATCGATAAGCAGTTTACCAAAGG - Intergenic
983781223 4:171673139-171673161 GTAGGTTAGAAGTTTTTCAAAGG + Intergenic
984147389 4:176079921-176079943 ATGGGTTAGCAGGTTATCATGGG - Intronic
984216802 4:176923312-176923334 TTAGTTTATCAATTTATCAACGG - Intergenic
986186241 5:5443075-5443097 TTTGGTTAATAGCTTATCAAAGG + Intronic
986588374 5:9343018-9343040 TTTGCTTAACAGTCTATCAATGG - Intronic
986822880 5:11487491-11487513 TGTGGTTATCAGTTTATCACTGG - Intronic
987488171 5:18546391-18546413 ATAGGTTAGGAGTTTTTCAAAGG + Intergenic
989082559 5:37639349-37639371 GTCAGTTAGCAGTCTATAAAAGG + Intronic
990530821 5:56671746-56671768 TTTGGTCACCAGTTTCTCAATGG + Intergenic
994235633 5:97358811-97358833 TTCAGTTAGCAGGTGATAAATGG + Intergenic
1005466381 6:26119289-26119311 TTCTCTTATCTGTTTATCAATGG + Intronic
1012222377 6:96664514-96664536 TTCAGTTAGCATGTTTTCAAGGG + Intergenic
1012635229 6:101529841-101529863 TTGTCTTAGCAGTATATCAAAGG + Intronic
1012788330 6:103659611-103659633 TTCCATTAGAAGTATATCAATGG - Intergenic
1020680549 7:11231994-11232016 TTTGCTGAGAAGTTTATCAAAGG + Intergenic
1021231373 7:18089047-18089069 TCTGGCTGGCAGTTTATCAAAGG - Intronic
1031487461 7:122345519-122345541 TTCTCTTTGCAGTTTATCTATGG + Intronic
1033626754 7:143117883-143117905 ATAGGTTAGGAGTTTTTCAAAGG + Intergenic
1038114326 8:24535795-24535817 TTCAGTTAGTTGTTTCTCAAAGG + Intergenic
1040729247 8:50422588-50422610 ATAGGTTAGGAGTTTTTCAAAGG + Intronic
1043154739 8:76764177-76764199 TACTGTAAGCAGTTTCTCAAAGG + Intronic
1045613261 8:103873503-103873525 TTAGGTTAGCAGTTGGCCAAGGG + Intronic
1045920142 8:107519918-107519940 ATAGGTTAGCACTTTAGCAATGG - Intergenic
1050087432 9:1980570-1980592 TTGGGTTAGCAGCTTTACAAAGG + Intergenic
1051116767 9:13704112-13704134 TTCAGTTACCACTTTAGCAAGGG - Intergenic
1051934290 9:22426043-22426065 TTTGGTTAGCAGTCTATCTGTGG - Intergenic
1052503857 9:29327747-29327769 TTAGGTTAACAATATATCAATGG + Intergenic
1058890283 9:109355377-109355399 TTGGGTCAGCAGTTTATCTCTGG + Intergenic
1185545094 X:937090-937112 ACCGCTTAGCAGTTAATCAATGG + Intergenic
1186021676 X:5263678-5263700 TTTGGTTGGCGGTTTTTCAAAGG + Intergenic
1186055837 X:5649032-5649054 TTAGGTTAGGGGTTTTTCAAAGG + Intergenic
1186566286 X:10666392-10666414 TTTTTTTTGCAGTTTATCAAGGG - Intronic
1187901526 X:24030703-24030725 TTCAGTTATGAGATTATCAAGGG + Intergenic
1188872314 X:35387997-35388019 ATAGGTTAGCGGTTTTTCAAAGG - Intergenic
1191611366 X:63117633-63117655 TTCTGTTAGCAGTGTCTCAGAGG - Intergenic
1191650249 X:63529418-63529440 TTCAGTTAGCAGGTGATGAATGG - Intergenic
1194184648 X:90760149-90760171 TACAGATACCAGTTTATCAAAGG - Intergenic
1194627518 X:96242874-96242896 GTAGGTTAGCTGTTTTTCAAAGG - Intergenic
1198925615 X:141788472-141788494 TTCAGTTAGCAGATGATAAATGG + Intergenic