ID: 1072573782

View in Genome Browser
Species Human (GRCh38)
Location 10:96681174-96681196
Sequence GACACAGATGTGTGCACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072573782_1072573790 22 Left 1072573782 10:96681174-96681196 CCGTGTGTGCACACATCTGTGTC 0: 1
1: 1
2: 4
3: 54
4: 330
Right 1072573790 10:96681219-96681241 ACACCAGTCATATTGGATAAGGG No data
1072573782_1072573788 15 Left 1072573782 10:96681174-96681196 CCGTGTGTGCACACATCTGTGTC 0: 1
1: 1
2: 4
3: 54
4: 330
Right 1072573788 10:96681212-96681234 TCTAAAGACACCAGTCATATTGG No data
1072573782_1072573789 21 Left 1072573782 10:96681174-96681196 CCGTGTGTGCACACATCTGTGTC 0: 1
1: 1
2: 4
3: 54
4: 330
Right 1072573789 10:96681218-96681240 GACACCAGTCATATTGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072573782 Original CRISPR GACACAGATGTGTGCACACA CGG (reversed) Intronic
901269116 1:7936990-7937012 GGCACAGACTTGGGCACACAAGG - Intronic
901907726 1:12428742-12428764 ATCAGAGATGTGTGCACAAATGG - Intronic
902090811 1:13901787-13901809 GAGACACATGTGTTCACACGTGG - Intergenic
902276854 1:15346086-15346108 GACTCAGATGTGTGAAAACAGGG + Intronic
903589173 1:24441209-24441231 GGCACAAGTGTGTGCCCACAGGG - Intronic
903842581 1:26254439-26254461 AACACAGTTGGGTACACACAAGG + Intronic
906274080 1:44503460-44503482 CACACTAATGTATGCACACATGG - Intronic
906522993 1:46478195-46478217 CACACACACCTGTGCACACACGG - Intergenic
907316097 1:53573699-53573721 CACGCAGATGCATGCACACATGG + Intronic
910402208 1:86848365-86848387 GACACAGATACATGCACAGATGG + Intergenic
911378164 1:97077112-97077134 GACTCAGGTGTGTACATACATGG + Intergenic
911444449 1:97972539-97972561 TGCAAAGATGTGTGCATACAGGG + Intergenic
911951488 1:104178506-104178528 GACACAGTTGTGGAAACACAGGG + Intergenic
911998518 1:104798923-104798945 CACAGACATGTGTGCACAGAGGG + Intergenic
913266106 1:117046389-117046411 GGCAAAGATCTGTACACACAAGG + Intergenic
915592176 1:156876732-156876754 GAGGCAGATGTGTGAACATAGGG + Intronic
915718572 1:157966684-157966706 GACACAGAAGTGTGCTCCAATGG + Intergenic
917204171 1:172552491-172552513 CACCCACATGTGTGCACACATGG - Intronic
919894901 1:202003488-202003510 GACATAAAGCTGTGCACACAAGG - Intronic
920892479 1:210003223-210003245 GACACAGACACTTGCACACATGG - Intronic
921229668 1:213056454-213056476 GACACCTATGTGTCCCCACAAGG + Intronic
921410825 1:214834962-214834984 GACACAGAGATGTGCAAACAGGG + Intergenic
922466119 1:225846415-225846437 TACAGAGATGTGTGCACAGCTGG + Exonic
923737748 1:236627532-236627554 GACACCAATCTATGCACACATGG - Intergenic
1063176531 10:3555479-3555501 TATACATATGTGTACACACATGG - Intergenic
1063428424 10:5967116-5967138 CACACACATGTGCACACACAAGG - Intronic
1064388904 10:14924112-14924134 GAGAAAGATGTTTCCACACAAGG + Intronic
1067142931 10:43671280-43671302 CACACAGATGAAGGCACACATGG + Intergenic
1067251087 10:44587658-44587680 GGCACAGCTGGGTGGACACATGG - Intergenic
1067692183 10:48508984-48509006 GAAACAGAGGTCTGCCCACAGGG + Intronic
1068512197 10:57981026-57981048 GACAATGATGTGAGCACACATGG - Intergenic
1068712388 10:60149142-60149164 CCCAGAGATGTGTACACACAAGG + Intronic
1070765590 10:79054342-79054364 TACACACACGTGTGCATACACGG - Intergenic
1071816123 10:89234120-89234142 GAGACAGATGTTTCCACAAAGGG + Intronic
1072573782 10:96681174-96681196 GACACAGATGTGTGCACACACGG - Intronic
1072714811 10:97743755-97743777 GAGATAGAAGTGTGGACACATGG + Intronic
1073161204 10:101397473-101397495 GACAGAGATCTGTCTACACATGG - Intronic
1074475251 10:113767874-113767896 GACACAGAGCTATGCACACAGGG - Intronic
1074805693 10:117049157-117049179 GACAGAGATGTTTGCAGTCATGG + Intronic
1076182936 10:128424735-128424757 CAGACAGATGTCTGCACAAAAGG - Intergenic
1076325591 10:129618321-129618343 GAAACAGAGCTGTGCATACATGG - Intronic
1076806948 10:132863469-132863491 GAGACGGGTGTGTGCACACCAGG - Intronic
1077000614 11:320419-320441 GCCACTGACGTGGGCACACACGG + Intronic
1077223830 11:1429399-1429421 GGCACAGGGGTGTGCACGCATGG + Intronic
1077373411 11:2194106-2194128 CTCACATGTGTGTGCACACAGGG - Intergenic
1077373416 11:2194150-2194172 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373420 11:2194192-2194214 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373425 11:2194234-2194256 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373430 11:2194276-2194298 CTCTCACATGTGTGCACACAGGG - Intergenic
1077373435 11:2194318-2194340 CTCTCACATGTGTGCACACAGGG - Intergenic
1080078265 11:28179093-28179115 CACACACCTGTGTGCACACATGG + Intronic
1080257527 11:30307384-30307406 GTCACAGAAGTGTGGACAAAAGG - Intergenic
1081227691 11:40544754-40544776 GACATACATATGTGCATACATGG - Intronic
1081493209 11:43582518-43582540 TACACACATGAGTGCCCACAGGG + Intronic
1081957291 11:47104513-47104535 GAAACAGAAGTTTGCACAGAGGG - Intronic
1082080361 11:48008000-48008022 GATACAGTGGTGAGCACACAGGG + Intronic
1082762191 11:57138175-57138197 GACACAGAGGCATGCACAGAGGG - Intergenic
1084265180 11:68001709-68001731 GAAACAGATGTAAGCACAGAAGG + Intronic
1084326128 11:68401203-68401225 CACACAGGTGTGTGCATTCATGG + Intronic
1085817694 11:79758000-79758022 CACATGCATGTGTGCACACATGG + Intergenic
1086400190 11:86455057-86455079 GCCACAGCTGTGTGAAGACAGGG - Intronic
1089081328 11:115778305-115778327 GACTCAAATGTGTGCCCACATGG + Intergenic
1090052306 11:123390317-123390339 GAAGCAGATGGGTGGACACAGGG - Intergenic
1090266754 11:125358263-125358285 CACATAGATGTGCACACACAGGG + Intronic
1090324574 11:125873926-125873948 AACAAAGATGTGGGCACACAGGG - Intergenic
1090488182 11:127133694-127133716 TACAGATATGTGTGCATACATGG + Intergenic
1090769348 11:129906085-129906107 GACACAAATGTATCCACACTTGG + Intronic
1091022303 11:132111485-132111507 AACACAGAGGTTTGGACACAAGG + Intronic
1091305550 11:134533641-134533663 GACACACATGTGTGCACACACGG - Intergenic
1091585940 12:1816773-1816795 CACACACATATATGCACACACGG + Intronic
1091693348 12:2611688-2611710 AACACAGATGTGTTCAGAGATGG + Intronic
1092785099 12:12019349-12019371 GACATAGAATTGTGCACAGAAGG - Intergenic
1094854801 12:34398149-34398171 ATCACTGATTTGTGCACACAGGG + Intergenic
1095638592 12:44460230-44460252 GCCTCAGATCTTTGCACACAGGG + Intergenic
1095989522 12:48025040-48025062 CACACAGATCTGTGCCCAAAGGG + Exonic
1097153420 12:56995724-56995746 GACCCAGATGCCTGCACACATGG - Exonic
1097990802 12:65831071-65831093 CACACAGACGTATACACACATGG - Intronic
1100829741 12:98506782-98506804 ACCAAGGATGTGTGCACACAGGG + Intergenic
1102199959 12:111050320-111050342 GATACAGATGAGGTCACACAGGG - Intronic
1102459449 12:113091227-113091249 TACAGAGACTTGTGCACACACGG - Intronic
1104795116 12:131511825-131511847 GACACAGATGTGGCCAGAGAAGG - Intergenic
1104798227 12:131534635-131534657 GAAACAGATGTGGTCACACATGG - Intergenic
1104810838 12:131619428-131619450 CACACAGATGTGCACACACATGG + Intergenic
1104929601 12:132330697-132330719 CACACAGATACATGCACACACGG - Intergenic
1104930270 12:132335512-132335534 CACACACATGCATGCACACACGG - Intergenic
1106033090 13:26020035-26020057 GACAAAGATGTGTTAACACTGGG - Exonic
1106346497 13:28884573-28884595 TACACACATGAGTACACACACGG + Intronic
1106586177 13:31058279-31058301 CACACACACGTGTGCACACCAGG - Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1107687639 13:42920035-42920057 GACACAGAAGCATGCATACAAGG - Intronic
1107975849 13:45688056-45688078 GACACTGACATGTGGACACATGG - Intergenic
1107987166 13:45785592-45785614 GACACATACATGTGCACACATGG + Intronic
1108032627 13:46251657-46251679 TACAGATATGTGTGTACACATGG - Intronic
1110369659 13:74725757-74725779 GAATCAGATGTTTGCAAACAAGG - Intergenic
1111586075 13:90286280-90286302 CACATACATGTGTACACACAAGG - Intergenic
1112429205 13:99335523-99335545 CAGACAGATGTGTGCACAAACGG + Intronic
1112495207 13:99898595-99898617 GTCACTGATGTGGGTACACAGGG - Intergenic
1113040203 13:106096558-106096580 GACACAGATCTCTGCTCTCAAGG - Intergenic
1113706856 13:112440648-112440670 GACACAGCTGTTGGCACATAGGG - Intergenic
1113807753 13:113119682-113119704 CACACAGATATGCACACACATGG + Exonic
1118907447 14:70032975-70032997 GACAGCTGTGTGTGCACACAGGG - Intergenic
1119678780 14:76576264-76576286 CACACAGATGTGTGCAGAGATGG - Intergenic
1119761391 14:77154583-77154605 GGCAGAGATGGGTGCACAGAGGG - Intronic
1120197199 14:81497359-81497381 GAAACCTGTGTGTGCACACATGG + Intronic
1120933180 14:89868887-89868909 GAAACAAATGTGTGCACACTAGG + Intronic
1121430106 14:93880483-93880505 TCCACAGAGGTGTGCAAACAGGG - Intergenic
1121731241 14:96188616-96188638 GACACGGATGCGCACACACAGGG + Intergenic
1122890170 14:104728584-104728606 GTCACAGGTGTGTGCACACTGGG + Intronic
1122996323 14:105267090-105267112 GACACAGTTGTGTGCATTAAAGG + Intronic
1123000898 14:105293570-105293592 GACACTGATGTGGGCTCACAGGG + Intronic
1123108397 14:105853750-105853772 CACATGGATATGTGCACACATGG - Intergenic
1123460363 15:20464839-20464861 GGCACACACGCGTGCACACATGG + Intergenic
1123657699 15:22535578-22535600 GGCACACACGCGTGCACACATGG - Intergenic
1124311608 15:28630776-28630798 GGCACACACGCGTGCACACATGG - Intergenic
1124583179 15:30980485-30980507 GTAACAGATGTGTGTACACCTGG + Intronic
1124708337 15:31983920-31983942 TATGCAAATGTGTGCACACATGG + Intergenic
1125783182 15:42289906-42289928 GACACAGATGCAGGCACAGAGGG + Intronic
1127585835 15:60376953-60376975 CACACACACGTGTGTACACACGG + Intronic
1129719014 15:77867634-77867656 AACAGAGACGTGTACACACAGGG - Intergenic
1130450664 15:84048596-84048618 GAAACAGACGCATGCACACAGGG + Intergenic
1130459916 15:84153230-84153252 AACAGAGACGTGTACACACAGGG + Intergenic
1131327488 15:91462007-91462029 GTAACAGATGTGTACACATATGG - Intergenic
1131667449 15:94585557-94585579 CACACAGCCGTGTGCTCACATGG - Intergenic
1132021453 15:98366054-98366076 GACACAGAGATGTGCACTAAGGG + Intergenic
1133343554 16:5055091-5055113 CACACAGACGTGTACACACAAGG - Intronic
1133436136 16:5781624-5781646 GACATAGACGTGTACACAAATGG + Intergenic
1133591085 16:7244409-7244431 GACAAAGATGTGTGCTGAAATGG - Intronic
1134346027 16:13392740-13392762 TACACAGAAATATGCACACACGG + Intergenic
1134516173 16:14889082-14889104 AACATAGTTCTGTGCACACATGG - Exonic
1134703846 16:16287729-16287751 AACATAGTTCTGTGCACACATGG - Exonic
1134868777 16:17632680-17632702 GACCCAGAGGTGGGAACACACGG - Intergenic
1134963697 16:18424385-18424407 AACATAGTTCTGTGCACACATGG + Exonic
1134967992 16:18506984-18507006 AACATAGTTCTGTGCACACATGG + Intronic
1135765406 16:25173507-25173529 GACACACACGTGTTCACACCTGG + Intronic
1136274645 16:29171523-29171545 CGCACAGCTGTATGCACACATGG - Intergenic
1136274663 16:29171897-29171919 CACACAGTTATATGCACACATGG - Intergenic
1136704776 16:32178015-32178037 GGCACACACGCGTGCACACATGG + Intergenic
1136763137 16:32751392-32751414 GGCACACACGCGTGCACACATGG - Intergenic
1136804963 16:33118994-33119016 GGCACACACGCGTGCACACATGG + Intergenic
1138385608 16:56633781-56633803 GACACAGCCGTGGGCACACTTGG - Exonic
1138583385 16:57955937-57955959 GTAACAGATGTGCGCACACTGGG - Intronic
1138631160 16:58295258-58295280 GACAAGCATGTGTGGACACAGGG - Intronic
1140176635 16:72667209-72667231 GACACAGGTGTGCACACACATGG - Intergenic
1140476816 16:75243103-75243125 GACACAGGTGTGAGAACAGAAGG + Intronic
1141635319 16:85311226-85311248 GGCACTGATGTGGGCACAAAGGG + Intergenic
1141990297 16:87605456-87605478 GACACAGATCTTTGCCCTCACGG + Intronic
1142078931 16:88137167-88137189 CACATAGCTGTATGCACACATGG - Intergenic
1142078936 16:88137279-88137301 CGCACAGCTGTATGCACACATGG - Intergenic
1142252139 16:88996849-88996871 GACACTGAGCTGTGCACGCAGGG - Intergenic
1142323867 16:89401768-89401790 GACACTGAGCTGTGCACGCAGGG + Intronic
1203065289 16_KI270728v1_random:1011714-1011736 GGCACACACGCGTGCACACATGG - Intergenic
1142508360 17:380217-380239 TACACAGAGGAGTACACACATGG + Intronic
1144031409 17:11326402-11326424 CACACAAATGAATGCACACAGGG - Intronic
1144464176 17:15483404-15483426 GACAAAGAGATGTGCACACAGGG + Intronic
1145787692 17:27604737-27604759 GACACACACGTGTCCACAGATGG + Intronic
1145825983 17:27877684-27877706 CACACAGCACTGTGCACACAGGG - Intronic
1145964409 17:28906671-28906693 CCCACAGGTGTGTACACACATGG + Intronic
1146185367 17:30720911-30720933 GACACAGGTGTGGGCTCACCTGG + Intergenic
1148130980 17:45262466-45262488 CACACACACTTGTGCACACAGGG + Intergenic
1150585634 17:66515358-66515380 TACACACACGTGTGCACACATGG - Intronic
1152048212 17:77952862-77952884 GACACAGAGATGCACACACAGGG - Intergenic
1152798374 17:82319784-82319806 GACACACGTGTGTGCAGAGACGG + Intergenic
1153473770 18:5474453-5474475 CACACACATGTGCACACACAAGG - Intronic
1153948617 18:10038433-10038455 CACACAGATCATTGCACACAGGG + Intergenic
1155127376 18:22891686-22891708 GACAAAGGTGTGTGTACACTAGG - Intronic
1155388833 18:25311466-25311488 GATACAGTTGTGTGCACATAAGG - Intronic
1158296431 18:56002131-56002153 AACACACATGTCTGCACTCAGGG + Intergenic
1158872734 18:61704247-61704269 AACACTCACGTGTGCACACATGG + Intergenic
1159957977 18:74533260-74533282 GACACAGTTGTGTGTAATCAGGG - Intergenic
1160376596 18:78418427-78418449 CACTCAGATGTATGCACACCAGG - Intergenic
1160490653 18:79334696-79334718 GACTTAGCTGTGAGCACACACGG - Intronic
1161005552 19:1934209-1934231 GACACAAATGCATGAACACATGG + Intergenic
1161598923 19:5168622-5168644 AATAAAGATGTGTGTACACATGG + Intronic
1161842414 19:6690758-6690780 GTCACCGGTGTGTCCACACATGG + Intronic
1162973406 19:14194785-14194807 GACACAGGTGTGGGCTCACCTGG - Intronic
1165146420 19:33733947-33733969 GACACCGCTGTCTGCTCACAGGG - Intronic
1165700434 19:37933162-37933184 GTCACAGATGAGGTCACACAGGG - Intronic
1166036634 19:40172938-40172960 GACCCAGATGTGTGGACCCCAGG - Intergenic
1166326712 19:42055314-42055336 CAGTCAGATGTGTCCACACAGGG - Intronic
1167528005 19:49997371-49997393 GACACAGATGGGAGCAAACCTGG + Intronic
1167676018 19:50886395-50886417 GACACATATGTGACCACACAAGG - Intergenic
1168326233 19:55539933-55539955 CACACACATGTGTGCATACATGG - Intergenic
925302163 2:2825056-2825078 TACACACATGCATGCACACAAGG - Intergenic
926942321 2:18151604-18151626 GACTCAGAGATATGCACACAGGG + Intronic
927108223 2:19845532-19845554 GGCACAGATGTGGTCACACATGG + Intergenic
927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG + Intergenic
928279181 2:29929259-29929281 GGCCCAGCTGTGTGCACACCAGG + Intergenic
928327557 2:30332145-30332167 CACACAGATGCATGCACACATGG - Intergenic
928691509 2:33804348-33804370 GACAGGGTTGTGTGCATACAGGG - Intergenic
929001054 2:37347088-37347110 TACACAGGTGTGTGCCCACCTGG - Intronic
929016892 2:37506437-37506459 TATACAGATGTGTGTTCACATGG - Intergenic
929335537 2:40739818-40739840 CACTGTGATGTGTGCACACATGG - Intergenic
929938970 2:46315859-46315881 GAGATAGATGTGTGTGCACATGG - Intronic
931157842 2:59655538-59655560 CCCACAGATTTGTGCCCACAGGG + Intergenic
932875965 2:75452385-75452407 AACATAGATGTGTGTACATATGG - Intergenic
933093226 2:78146459-78146481 GCCCCAAATGTGTGCACACCCGG - Intergenic
933102987 2:78283686-78283708 GACACAGATGTATGCAGATTGGG + Intergenic
933222577 2:79707399-79707421 GACATAGTTCTGTACACACAGGG - Intronic
935829111 2:106981103-106981125 GACACAGAAATGTACAAACAGGG - Intergenic
937062220 2:118989241-118989263 GGGACAGGTGTGTGCACAAATGG + Intronic
937322225 2:120967630-120967652 CACACATATGTGTGGACACATGG - Intronic
937444330 2:121944186-121944208 AACACAGATTTGGGAACACATGG + Intergenic
937752635 2:125495737-125495759 AACATATATGTGTTCACACAAGG - Intergenic
938143438 2:128813907-128813929 GAACCAGATGTGTGTCCACAGGG - Intergenic
938255358 2:129855168-129855190 ACCAGGGATGTGTGCACACAAGG - Intergenic
939272358 2:139956463-139956485 GACAGAGAAGTGTGCAGACTTGG - Intergenic
939775555 2:146383341-146383363 GACACATATGTGTGTATATATGG + Intergenic
939775751 2:146385604-146385626 GAAACAGCTGTGGGCACTCAAGG - Intergenic
940790480 2:158025731-158025753 TACACAGATGTGTACACATATGG - Intronic
941414754 2:165206161-165206183 GACACAGAGGCATGCACAGAGGG - Intergenic
943362167 2:186932621-186932643 GAAAGAAATGTATGCACACAAGG + Intergenic
944588193 2:201191532-201191554 AACACAGATGTTTCCACACCAGG + Intronic
945085925 2:206132228-206132250 GAGACAGATATGTGCAGAAATGG - Intronic
945151370 2:206795564-206795586 GGCACACCTGTGTGCACAAATGG - Intergenic
945692733 2:213060840-213060862 GACTCAGGTTTGTGAACACAAGG + Intronic
945897040 2:215495244-215495266 GAGGCAGATGTGTGCATAAAAGG - Intergenic
946449402 2:219766793-219766815 GTCAGAGATGTCTGCCCACAAGG - Intergenic
946676625 2:222167415-222167437 GACAGAGATTTGTGCGCAGAAGG + Intergenic
947315296 2:228851179-228851201 GACACAGATGCATGCACGGAGGG + Intronic
947990489 2:234483946-234483968 GACACAGAGACCTGCACACAGGG + Intergenic
948309771 2:236976481-236976503 CACACAGATGTGTCCTCACCAGG + Intergenic
948359150 2:237406296-237406318 GACACACACGCATGCACACAAGG + Intronic
1170144343 20:13155882-13155904 GACCCAGATCTGTGAACAAAGGG - Intronic
1170580509 20:17695920-17695942 GACATAGAAGAGTACACACATGG - Intronic
1170850418 20:19999113-19999135 GACACAGAGGTCTTCTCACATGG + Intronic
1175201275 20:57279582-57279604 GACTCAGAGGTGAGCAGACAAGG - Intergenic
1175222670 20:57426298-57426320 GACACTGAGGTCTGCACAGATGG + Intergenic
1175759887 20:61555012-61555034 CACACAGGTGTGCACACACATGG - Intronic
1175826415 20:61938743-61938765 GGCACAGATGTGTGCACTCAAGG - Exonic
1176081860 20:63277533-63277555 GACACGGCTGTGTGCACACCTGG - Intronic
1176369732 21:6055600-6055622 CACACAGAGACGTGCACACACGG + Intergenic
1177873007 21:26596136-26596158 TGCACAGATGGGTGCACAGATGG + Intergenic
1177931849 21:27295313-27295335 GAGACAGATGTTTGTACACAGGG - Intergenic
1178608622 21:34060402-34060424 GGCAAAGATGTGGGCACAGAGGG + Intergenic
1178812335 21:35895633-35895655 GACACAGAGACATGCACACAGGG + Intronic
1179288033 21:39994946-39994968 GTCCCAGATGTGGGCTCACAGGG + Intergenic
1179753787 21:43482941-43482963 CACACAGAGACGTGCACACACGG - Intergenic
1180188952 21:46153708-46153730 GCCAAAGGTGTGTGGACACACGG - Intronic
1180855273 22:19041391-19041413 GGCACAGGTGTGTGCACTCAGGG - Intronic
1181048071 22:20225886-20225908 CACACACATGCATGCACACATGG + Intergenic
1181274839 22:21681828-21681850 GAGACAGCCGTGTTCACACATGG + Intronic
1182805069 22:33062533-33062555 CATACAGATGGATGCACACACGG + Intergenic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1184464800 22:44662536-44662558 TACACACATTTGTGCCCACAGGG - Intergenic
1184600521 22:45540729-45540751 GTCAGAGATGTGTCCACTCAAGG + Intronic
1184709360 22:46239447-46239469 GGCTCAGGTGTGTGCACTCAAGG - Exonic
1184779466 22:46639709-46639731 TATACACATGTGTACACACACGG - Intronic
1184941300 22:47767371-47767393 CACACAAAGCTGTGCACACATGG + Intergenic
1185093697 22:48792975-48792997 GACACAGATGCAGACACACATGG - Intronic
949549231 3:5098385-5098407 GACACAGAGACATGCACACAGGG + Intergenic
950187728 3:10955780-10955802 GACAATGATGTGTGCTCAGAAGG + Intergenic
950413656 3:12855748-12855770 CACCCAGATGTGTGCACCTAAGG - Intronic
950478704 3:13231291-13231313 TGCACACATGTGTGCACACGTGG - Intergenic
953364651 3:42333416-42333438 CACACAAATGTGGGCAGACAGGG - Intergenic
953455067 3:43034474-43034496 GATACACATGTGTGGAAACATGG + Intronic
953795728 3:45984567-45984589 AACACACATGTGTGCACTAATGG + Intronic
955384897 3:58471521-58471543 GAGTCAGATGTTTGCACAGAAGG + Intergenic
955804936 3:62723978-62724000 GACACAGAAGTGCCCACATAAGG - Intronic
955817835 3:62864610-62864632 GACCCAGAGATATGCACACACGG - Intronic
958580267 3:96009162-96009184 GGCACAAAAATGTGCACACATGG + Intergenic
959963610 3:112330345-112330367 GACACAGAAGAGTGAACAAAAGG - Intergenic
961326227 3:126111007-126111029 GACACAGAGCTGTGCACACAAGG - Intronic
961653685 3:128429896-128429918 TACACATGAGTGTGCACACAGGG + Intergenic
964623445 3:158737066-158737088 GAAGCAGATGTGTCCCCACAAGG + Intronic
964722212 3:159778838-159778860 GAGAGAAATATGTGCACACACGG + Intronic
965752245 3:171987986-171988008 GACACACACATGTGCACACAAGG + Intergenic
967113792 3:186318632-186318654 GACACAGAGATATGCACACAGGG + Intronic
967763813 3:193255469-193255491 AACACTGATGTGTGCACAAGGGG - Intronic
968228048 3:196988276-196988298 GTGACGGATGTGTGTACACAAGG - Intergenic
968447544 4:659712-659734 CACACACATGGGTGCACACACGG - Intronic
969266002 4:6064500-6064522 CCCACGCATGTGTGCACACACGG - Intronic
969295183 4:6265828-6265850 GACAGAGATTTGACCACACACGG - Intergenic
969605174 4:8198833-8198855 AGCACAAGTGTGTGCACACATGG - Intronic
969622339 4:8284913-8284935 GACAGAGATGTTTGCTCCCATGG + Intronic
969846946 4:9926834-9926856 GACACAGATAGATACACACAGGG + Intronic
971769260 4:30875244-30875266 GACACAGAGATGTGCATACAAGG - Intronic
972387770 4:38584539-38584561 GCCACAGACGTGTGCCCCCATGG - Intergenic
972722725 4:41716562-41716584 GACACAGATATATGCAAACAGGG + Intergenic
974528814 4:63080650-63080672 AACACAGCTGTGTGGACTCAAGG - Intergenic
974546447 4:63314839-63314861 AACACACATTTGAGCACACAGGG + Intergenic
974697879 4:65398257-65398279 CAGGCAGATGTGTGCACACTTGG + Intronic
976102986 4:81585433-81585455 AACACAAATGTATGCACACATGG + Intronic
981397918 4:144275867-144275889 GACACAGATGTGTAAATGCATGG + Intergenic
982836982 4:160131251-160131273 GACACAGGTATATGCAAACATGG - Intergenic
982977303 4:162080392-162080414 TACACAGTTTTGTGCACAGAAGG - Intronic
984836306 4:184025171-184025193 GACAGTGGTCTGTGCACACAAGG - Intergenic
985530496 5:431162-431184 GACAGGGCTGTGCGCACACAGGG - Intronic
985716451 5:1465753-1465775 TACACAAACGTGTGCACACACGG + Intronic
985730561 5:1545180-1545202 GATGCAGGTATGTGCACACAGGG - Intergenic
985846847 5:2356097-2356119 GAGACAGATGTGTTCACAAAGGG - Intergenic
988326365 5:29773738-29773760 GAGACAATTGTGTCCACACATGG - Intergenic
991315877 5:65305791-65305813 GACACACACATATGCACACATGG + Intronic
992846942 5:80759850-80759872 GACAGAGCTTTGTACACACACGG - Intronic
993092981 5:83449997-83450019 CACACATATGTGCCCACACATGG + Intergenic
993826721 5:92697001-92697023 GAAACAAATGTATACACACAGGG - Intergenic
994029580 5:95126557-95126579 GATGCATATGTGTGCACACAGGG - Intronic
994386194 5:99135700-99135722 GACACAGAGACATGCACACAAGG - Intergenic
998375968 5:141691022-141691044 GACCCAGAGGTTTGCACACTTGG + Intergenic
999376895 5:151093058-151093080 AGCACAGCTGTGTGCACAAAAGG + Intronic
999588698 5:153120072-153120094 GGCACAGATGTGTGACCATATGG - Intergenic
1000695945 5:164384115-164384137 GACACTGATGTTTGACCACAAGG - Intergenic
1001237060 5:170038929-170038951 AACACCTGTGTGTGCACACATGG - Intronic
1001860878 5:175053992-175054014 GGCCCAGATGTGTGAGCACAGGG - Intergenic
1001900284 5:175421339-175421361 GACACAGCTGTGAGAACACAGGG + Intergenic
1002135282 5:177103932-177103954 GACTGAGATGTGCACACACAGGG + Intergenic
1002359163 5:178656402-178656424 GACACAGATGATTAGACACATGG + Intergenic
1002647905 5:180670763-180670785 GTCTCAGACGTGTGGACACATGG - Intergenic
1003877710 6:10452930-10452952 CACACAGGTGCGCGCACACACGG - Intergenic
1004545900 6:16597841-16597863 GCCAGAGATGTGTGCACTCCTGG - Intronic
1005693100 6:28326430-28326452 GACACAGAAGAATCCACACAGGG - Exonic
1005805105 6:29467423-29467445 GACAACGATGTGAGGACACAGGG + Intergenic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1009201039 6:60746205-60746227 TTCACATATGTGTGCACTCATGG + Intergenic
1011197617 6:84798319-84798341 TCCACAGATGTGTCCACAGAAGG - Intergenic
1012310246 6:97714988-97715010 ACCAGAGCTGTGTGCACACAGGG - Intergenic
1014254788 6:119150154-119150176 GACACAGAGGTACCCACACAAGG + Intergenic
1014264157 6:119255777-119255799 AAGAAAGATGTGTGCCCACAGGG - Intronic
1015223350 6:130829520-130829542 ATCACAGAGGTGTACACACATGG - Intronic
1016224112 6:141713053-141713075 GAAACTGATGTCTGAACACAGGG - Intergenic
1017433160 6:154391163-154391185 GACACAGATATGTATGCACATGG - Exonic
1017505108 6:155061179-155061201 GATATAAATGTGTGTACACATGG - Intronic
1018433886 6:163744302-163744324 GACACAGAGATGGGCACGCACGG - Intergenic
1018473566 6:164118539-164118561 GAGACAGATGTGTAAACAGATGG + Intergenic
1018483132 6:164212394-164212416 GACACAGGTCTCTGGACACAGGG - Intergenic
1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG + Intronic
1019205472 6:170358044-170358066 CACACAGAGGTGCACACACATGG - Intronic
1020807114 7:12803797-12803819 GACACATATGTGAACACAGACGG + Intergenic
1021585191 7:22200137-22200159 GACACAGATGTGGGCATTGATGG - Intronic
1022522230 7:31015871-31015893 CACACACATATGTACACACAAGG + Intergenic
1022528979 7:31055225-31055247 CACACAGATCTGGGCACACCCGG + Intronic
1026014552 7:66662773-66662795 CACACACATGCGTGCACACACGG - Intronic
1026100547 7:67380922-67380944 CATACATGTGTGTGCACACATGG - Intergenic
1026857038 7:73762021-73762043 GACACAGATGTGTGTGCACATGG + Intergenic
1028109457 7:86921341-86921363 GTCACAGATGTAGACACACAGGG + Intronic
1028505378 7:91564823-91564845 CACACAGAGGTCTCCACACATGG - Intergenic
1030973282 7:116088851-116088873 TACACAGATGTGGGCAGAGAGGG + Intronic
1031510862 7:122648224-122648246 GACAGAGTTCTGTGGACACAAGG - Intronic
1031681756 7:124683497-124683519 CACACATAGATGTGCACACAGGG + Intergenic
1033454485 7:141490377-141490399 GACACAGAGACGTGCACATAGGG + Intergenic
1034313738 7:150111397-150111419 TACACACACGTGTGCACACAGGG - Intergenic
1034793161 7:153989399-153989421 TACACACACGTGTGCACACAGGG + Intronic
1034946426 7:155265254-155265276 TATACCTATGTGTGCACACATGG - Intergenic
1035395238 7:158530631-158530653 GGCACACATATATGCACACATGG - Intronic
1038542453 8:28401603-28401625 TACACACATGCGTGCACACACGG - Intronic
1039840553 8:41290148-41290170 AACACACATGTGTGCACAGCAGG + Intronic
1041958429 8:63583270-63583292 GGCACAGAGATGTGCACAGAGGG + Intergenic
1041988379 8:63954532-63954554 GACCCAGGTGTGGGCACAAAAGG - Intergenic
1043752313 8:83953200-83953222 CACACATATGTGGGCCCACATGG - Intergenic
1044088909 8:87975133-87975155 GGCACAGTGGTGTGCACCCATGG + Intergenic
1044282541 8:90373307-90373329 GACAGAGATGTGTGTGCACATGG + Intergenic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1046079040 8:109348233-109348255 TACACACATATGTACACACATGG + Intergenic
1048360892 8:133696427-133696449 TGCACTCATGTGTGCACACAGGG - Intergenic
1049396742 8:142404444-142404466 GGCACAAATGTGTGCACACATGG + Intergenic
1049642817 8:143723025-143723047 GACACAGGTCTGTGCCCACAGGG - Intergenic
1050128309 9:2382675-2382697 GACACAGAGATATGCACAGAGGG - Intergenic
1050663072 9:7905006-7905028 GAGATAGTTGTCTGCACACATGG - Intergenic
1050797544 9:9562903-9562925 GGCAAAGATGTCTGCCCACATGG - Intronic
1051849651 9:21491486-21491508 AACACATGTGTATGCACACACGG - Intergenic
1055163536 9:73162031-73162053 GAAGCAGATGTGTGCAGAGAGGG + Intronic
1056705417 9:88948593-88948615 GACACAGACACATGCACACAGGG - Intergenic
1056923336 9:90811311-90811333 GACACAGATGGGTGCTGACAGGG + Intronic
1057308927 9:93929382-93929404 GACTGAGCTGTGTGCACAGAGGG + Intergenic
1057859390 9:98627621-98627643 CACACAGAAGTGTCCACACAGGG + Intronic
1057870729 9:98715015-98715037 GTCACAGGTGTGAGCACAGAAGG - Intergenic
1058385856 9:104435034-104435056 GAAACAGATGTGAGCACATTGGG - Intergenic
1058975658 9:110123378-110123400 GACACAGAGATGTGCATAGAGGG - Intronic
1059163863 9:112060532-112060554 GAGGCAGAGGTGGGCACACAGGG - Intronic
1061416227 9:130448394-130448416 CACACACCTGTGTGCACCCAGGG - Intronic
1062177169 9:135169892-135169914 CACACACATGTGCTCACACATGG - Intergenic
1062324072 9:136004165-136004187 CACATAGATCTGAGCACACAGGG - Intergenic
1062731383 9:138112141-138112163 GACACACACGTGTGCACATGAGG + Intronic
1203376870 Un_KI270442v1:383585-383607 GACACACATGGGTGCACATGCGG - Intergenic
1186607651 X:11108855-11108877 GACACAAAATTGTGGACACACGG + Intergenic
1187409956 X:19042504-19042526 ACCACAGCTGTGTACACACAGGG + Intronic
1187495037 X:19788319-19788341 GACACAGAGATATGCACACAGGG + Intronic
1187989964 X:24859575-24859597 GCCACAGAGGTGTGTACAAAAGG - Intronic
1188099395 X:26064547-26064569 CACACACGTGTGTGCACATATGG + Intergenic
1189224200 X:39398852-39398874 GACTCAGACTTGTGTACACATGG - Intergenic
1189230311 X:39447140-39447162 GACACAGAGGCATGCACACAGGG - Intergenic
1190375838 X:49787501-49787523 CACACAGCTCTGTGCACACGTGG + Intergenic
1190710085 X:53061443-53061465 CAGACAGATATGTGCACACGGGG - Intronic
1190737322 X:53264295-53264317 GAGAAATATGTGTGCACGCATGG - Intronic
1191105875 X:56771937-56771959 GATCCAGATGTGTGCAGGCAGGG + Intergenic
1191106868 X:56777339-56777361 GATCCAGATGTGTGCAGGCAGGG + Intergenic
1194036478 X:88879937-88879959 CACACACATGTGCACACACACGG - Intergenic
1195209556 X:102640086-102640108 GACACAGAGGCAAGCACACAGGG + Intergenic
1195704615 X:107729811-107729833 GACATGGATGTGTTTACACAGGG - Intronic
1200322977 X:155209142-155209164 GACACAGAACTGTGCAGACCTGG + Intronic
1200818581 Y:7559104-7559126 GACACAGTTGGGTACACACATGG + Intergenic