ID: 1072574242

View in Genome Browser
Species Human (GRCh38)
Location 10:96685724-96685746
Sequence GGACATGTGGACATGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574242_1072574248 -2 Left 1072574242 10:96685724-96685746 CCAGGGTCCATGTCCACATGTCC 0: 1
1: 0
2: 0
3: 19
4: 291
Right 1072574248 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG No data
1072574242_1072574250 27 Left 1072574242 10:96685724-96685746 CCAGGGTCCATGTCCACATGTCC 0: 1
1: 0
2: 0
3: 19
4: 291
Right 1072574250 10:96685774-96685796 AGAGTTAATTCTGACAACACAGG No data
1072574242_1072574251 28 Left 1072574242 10:96685724-96685746 CCAGGGTCCATGTCCACATGTCC 0: 1
1: 0
2: 0
3: 19
4: 291
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574242_1072574246 -3 Left 1072574242 10:96685724-96685746 CCAGGGTCCATGTCCACATGTCC 0: 1
1: 0
2: 0
3: 19
4: 291
Right 1072574246 10:96685744-96685766 TCCTGGTCCGATGCAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574242 Original CRISPR GGACATGTGGACATGGACCC TGG (reversed) Intronic
900528945 1:3143269-3143291 GGAAGTGTGGACATGGGTCCGGG + Intronic
900542468 1:3210317-3210339 GGAGATGAGGACATGCTCCCTGG + Intronic
902834873 1:19040502-19040524 GGACATCTGGGCATGATCCCCGG - Intergenic
903276952 1:22228470-22228492 GTCCATGGGGACATGGACCCAGG + Intergenic
905462513 1:38130921-38130943 GGACAAATGGAGATGGTCCCTGG - Intergenic
907650034 1:56286234-56286256 AGACATGTGGCAATGGCCCCTGG - Intergenic
907878700 1:58522290-58522312 GCACATCTGCACATGTACCCTGG + Intronic
908115699 1:60937871-60937893 GGACAGGTGGACATGGGCCAAGG - Intronic
908300385 1:62756495-62756517 GGAGAAGGGGACATGTACCCGGG - Intergenic
908875310 1:68667719-68667741 TGGCATGTGGACTTGAACCCAGG - Intergenic
910023817 1:82624631-82624653 GGACATGTGGACTTAGATGCTGG + Intergenic
911845650 1:102747868-102747890 GGAGAAGGGGACATGTACCCAGG + Intergenic
912774874 1:112499975-112499997 GGTCATGTTGACATGAACCAGGG + Intronic
913469485 1:119174530-119174552 GGAGAAGGGGACATGTACCCGGG - Intergenic
913713479 1:121510792-121510814 GGAGAAGGGGACATGTACCCAGG - Intergenic
914880543 1:151543090-151543112 TCACATGTGGACATGGACATAGG + Intronic
916114408 1:161474799-161474821 GGAGAAGGGGACATGTACCCAGG - Intergenic
916939498 1:169664243-169664265 GGAGAAGGGGACATGTACCCAGG - Intronic
917088689 1:171329670-171329692 TGTCATGTTGACATGGAGCCAGG - Intronic
917227546 1:172800629-172800651 GGAGAAGGGGACATGTACCCAGG - Intergenic
917445829 1:175105283-175105305 GGAGAAGGGGACATGCACCCGGG + Intronic
918118022 1:181513767-181513789 GGACATGCAGGCAAGGACCCAGG - Intronic
918750206 1:188261495-188261517 GGAGAAGGGGACATGTACCCAGG + Intergenic
919746518 1:201012280-201012302 AGACAGGGGGGCATGGACCCTGG + Intronic
920305112 1:205013776-205013798 GGACAAGGGGACCTGGGCCCAGG - Intronic
920824503 1:209412893-209412915 GGAGATGTGGACAAGGAAGCTGG + Intergenic
921261639 1:213389613-213389635 GCACATGGGGACCTGGAGCCCGG - Intergenic
1062923286 10:1296111-1296133 GAGCAGGTGGACTTGGACCCTGG - Intronic
1063129368 10:3164389-3164411 GGACATGAAGACATGGGCCCAGG + Intronic
1063321729 10:5058003-5058025 GGAGAAGGGGACATGTACCCGGG + Intronic
1063414774 10:5864402-5864424 GGAGAAGGGGACATGTACCCGGG - Intronic
1063463930 10:6231322-6231344 GGACAGAGGGACATGCACCCAGG - Intronic
1064315251 10:14249508-14249530 GGACATGAGGAGATGGACACTGG - Intronic
1064463189 10:15554563-15554585 GCACATATGCACATGCACCCAGG + Intronic
1065082385 10:22141029-22141051 GGAGAAGGGGACATGTACCCAGG - Intergenic
1065200142 10:23304685-23304707 GGAGAAGTGGCCATGGACCATGG - Intronic
1065771360 10:29081671-29081693 GGACATGTGGGCCTGGATGCTGG + Intergenic
1066048738 10:31617069-31617091 GGACATAGGGACATGGAACAAGG + Intergenic
1067687654 10:48476788-48476810 GGACATGTGGCCGGGGAGCCAGG + Intronic
1067812765 10:49442690-49442712 GGGCAGGTGGCCATGGAACCAGG + Intergenic
1068404977 10:56575990-56576012 GGAGAAGGGGACATGTACCCAGG + Intergenic
1069365113 10:67688202-67688224 GGAGAAGGGGACATGTACCCGGG + Intronic
1069918756 10:71803214-71803236 TTCCATGTGGACATGGACTCGGG + Exonic
1072307319 10:94120166-94120188 GGGCAGGAGGACATGGAGCCTGG - Intronic
1072574242 10:96685724-96685746 GGACATGTGGACATGGACCCTGG - Intronic
1074676609 10:115858666-115858688 GCACATCTGCACATGGACCTCGG + Intronic
1075146307 10:119885747-119885769 GGAGAAGGGGACATGTACCCAGG - Intronic
1075296040 10:121276246-121276268 ACACATGTGCACATGGACACAGG - Intergenic
1077283767 11:1756943-1756965 GCACATGTGGTCCTGGTCCCGGG - Intronic
1078019877 11:7648098-7648120 GGACATGTGAACATGATCTCAGG + Intronic
1079731241 11:23939356-23939378 GGAGAAGGGGACATGTACCCAGG + Intergenic
1080885858 11:36367638-36367660 GGACAACTTGACCTGGACCCTGG + Intronic
1081421404 11:42877195-42877217 GGACAAGGGGACATGTACCCGGG - Intergenic
1081540640 11:44032243-44032265 GGACATGTAGAGAGAGACCCTGG - Intergenic
1082944995 11:58749153-58749175 GGACATGAGGCCCTGGCCCCGGG + Intergenic
1084210986 11:67622254-67622276 GGAGAAGGGGACATGTACCCGGG - Intergenic
1085335132 11:75687736-75687758 GGACAGGTGGCCATGGTCTCAGG - Intergenic
1085480066 11:76814462-76814484 GGACATGTGGAGTTAGACACTGG - Intergenic
1085748813 11:79140895-79140917 GGATCTGTGGACCTGGAGCCAGG + Intronic
1085982074 11:81737259-81737281 GGACCTGTGGACAAGTACCCTGG - Intergenic
1087074983 11:94120404-94120426 GGAGAAGGGGACATGTACCCAGG - Intergenic
1087150963 11:94859229-94859251 TGACCTGTGGAGATAGACCCAGG + Intronic
1087683349 11:101238440-101238462 GGAGAAGGGGACATGTACCCGGG + Intergenic
1088161062 11:106871010-106871032 GGAAATATGGACATGGTCCTTGG - Intronic
1091825631 12:3510653-3510675 GGCCTTGTGGACAAGGCCCCAGG - Intronic
1092915752 12:13187626-13187648 TGACAAGTGGGCAGGGACCCAGG - Intergenic
1094338122 12:29383534-29383556 GGAGAAGGGGACATGTACCCGGG + Intergenic
1094422106 12:30281291-30281313 GGAAATGTGGGCAGGGACACAGG - Intergenic
1094536298 12:31325000-31325022 GGACATTCGGACAAGGACCAGGG + Intronic
1095945194 12:47749671-47749693 GCCCATGAGGACATGGACCAGGG + Intronic
1096612240 12:52810056-52810078 GTACATGTGGACATAGAGCATGG + Intronic
1101618511 12:106361131-106361153 GCACATGAGGACATGTACACTGG + Intronic
1101704863 12:107212071-107212093 GGAGAAGGGGACATGTACCCAGG - Intergenic
1101779648 12:107823940-107823962 GGAGAAGGGGACATGTACCCAGG - Intergenic
1102590801 12:113955449-113955471 GGGCACCTGGACAGGGACCCTGG + Intronic
1104809571 12:131612190-131612212 GGACACGGGGACATAGACGCTGG - Intergenic
1105329631 13:19403311-19403333 GGCCATGTGGTCAGGGACGCTGG + Intergenic
1105529188 13:21202896-21202918 GGAGATGTGAACATAGACACTGG - Intergenic
1108830278 13:54469232-54469254 GGACATGTGGAAAGGACCCCAGG + Intergenic
1109152499 13:58861265-58861287 GGGCCTGTGGCCATGGACCTAGG - Intergenic
1109204564 13:59467067-59467089 GGACACCTGGACAAGGACCCAGG + Intergenic
1111167892 13:84486578-84486600 ATACATGTGCACATGTACCCTGG + Intergenic
1111475896 13:88747107-88747129 CGTCATATGGACATGCACCCAGG - Intergenic
1112519105 13:100080497-100080519 GGAGAAGGGGACATGTACCCGGG - Intergenic
1112538356 13:100283014-100283036 GGAGAAGGGGACATGTACCCGGG - Intronic
1113203940 13:107895094-107895116 GGAGAAGGGGACATGTACCCAGG + Intergenic
1115285472 14:31709717-31709739 GGAGAAGGGGACATGTACCCAGG + Intronic
1121913907 14:97818780-97818802 GGGCATGTGGACATGAGCCAAGG + Intergenic
1122264927 14:100542117-100542139 GGACAGGAGGACATGGGCTCGGG - Intronic
1125583410 15:40803577-40803599 GGACATGTGGAGATGGAGGCAGG - Intronic
1126072087 15:44874196-44874218 GGAGAAGGGGACATGTACCCAGG + Intergenic
1126345150 15:47685719-47685741 GAACATGTGAACAAGGATCCTGG + Intronic
1128775449 15:70316689-70316711 GGAAATGTGAAACTGGACCCAGG + Intergenic
1129558414 15:76538780-76538802 GGATATGTAGAAATGGAACCTGG + Intronic
1129964822 15:79725044-79725066 GGACATGTGGAGGTGGACTCTGG - Intergenic
1132012709 15:98290200-98290222 GGCCAGGTGGACACGGACCCTGG - Intergenic
1132394343 15:101460881-101460903 GGAACTGTGGACATGACCCCGGG + Intronic
1132507291 16:317467-317489 GGACTCGTGGACATCGGCCCTGG - Intronic
1133498438 16:6342294-6342316 GGACATGTGGAAATGCATTCTGG + Intronic
1134282983 16:12834354-12834376 GCACATGTGGGCATGCTCCCTGG - Intergenic
1135053170 16:19208773-19208795 GGACATTTAGACATGCACACAGG - Intronic
1139170826 16:64627738-64627760 GGGCCTGTGGCCATGGACCTAGG + Intergenic
1139313003 16:66042900-66042922 GGACTGGTGGTCATGGACCAAGG + Intergenic
1140608024 16:76564349-76564371 GGACATGTTAACATGGTCTCAGG - Intronic
1142160057 16:88552671-88552693 GGACCTGTGGATGTGGAACCAGG + Intergenic
1142328452 16:89433953-89433975 GGAGAAGGGGACATGGACACTGG + Intronic
1142990858 17:3729908-3729930 GCACATCTGCACATGTACCCTGG - Intronic
1144169886 17:12649394-12649416 AGACCTGTGTAAATGGACCCTGG - Intergenic
1144248683 17:13394258-13394280 GGACATGGGGAGATGGCCTCAGG - Intergenic
1144666872 17:17107966-17107988 GGACATGTGGCCAGGGCTCCGGG - Intronic
1144778015 17:17794596-17794618 GAACAGGTGGACACGGACTCGGG - Exonic
1149073880 17:52575389-52575411 GGAGAAGGGGACATGTACCCGGG - Intergenic
1152564223 17:81093007-81093029 GGGCATGTGGACACGTCCCCCGG - Intronic
1153194390 18:2577745-2577767 GAACTAGTGGACATGGATCCCGG + Exonic
1153275736 18:3365852-3365874 GGAGATGGGGACATGGACAGAGG + Intergenic
1155388113 18:25303089-25303111 GGACATGGTGACATGAACTCTGG + Intronic
1155537716 18:26834072-26834094 GGACATCTGGACTTGAATCCAGG + Intergenic
1157139327 18:45089875-45089897 AGACAAGTAGACATGGGCCCTGG + Intergenic
1157857918 18:51118279-51118301 GGAGAAGGGGACATGTACCCGGG + Intergenic
1157987695 18:52458308-52458330 AGACATGTGGTCAGTGACCCTGG - Intronic
1160381108 18:78456839-78456861 GGGGATGTGGAGGTGGACCCAGG + Intergenic
1160581501 18:79886439-79886461 GGACGTGGGGACAGGGACACGGG + Intronic
1160581594 18:79886716-79886738 GGACGTGGGGACAGGGACACGGG + Intronic
1160692938 19:468223-468245 AGACATGTTGACATGCACCTGGG + Intronic
1160925066 19:1540383-1540405 GGACAGGTGGTGGTGGACCCTGG - Intergenic
1160973253 19:1779799-1779821 GGACAGGTGGACGGGGCCCCAGG + Exonic
1161322792 19:3649054-3649076 GGACGTGTGGGCATGGTGCCGGG - Intronic
1161322805 19:3649104-3649126 GGACGTGTGGGCATGGTGCCGGG - Intronic
1161322818 19:3649154-3649176 GGACGTGTGGGCATGGTGCCGGG - Intronic
1161322831 19:3649204-3649226 GGACGTGTGGGCATGGTGCCGGG - Intronic
1161322844 19:3649254-3649276 GGACGTGTGGGCATGGTGCCGGG - Intronic
1161322909 19:3649504-3649526 GGACGTGTGGGCATGGTGCCGGG - Intronic
1161952928 19:7477639-7477661 GGATTTGAGGACTTGGACCCGGG - Intronic
1162237495 19:9320761-9320783 GGAGAAGGGGACATGTACCCGGG + Intergenic
1163205320 19:15798339-15798361 GGAGATGAGGACAGGGTCCCGGG - Intergenic
1165847060 19:38824934-38824956 GGAGAAGGGGACATGTACCCGGG - Intronic
1165881694 19:39048583-39048605 GGACATGAGGAGATGGTACCTGG - Intergenic
1166305622 19:41935540-41935562 GGACAGGTGGACAGGGACAAGGG + Intergenic
1167438032 19:49491154-49491176 GGACCTGGGGACCTGGAGCCTGG + Intronic
1168726592 19:58586240-58586262 GGCCATCTGGACATGAAGCCTGG - Intergenic
925424689 2:3739288-3739310 GGACAGGAGGGCATGGTCCCTGG + Intronic
925949924 2:8900493-8900515 GGAGAAGGGGACATGTACCCAGG + Intronic
926055945 2:9774098-9774120 GGACATTTGGACACAGACACAGG - Intergenic
927510459 2:23641095-23641117 GGCCATGGAGACCTGGACCCAGG + Intronic
927889871 2:26741601-26741623 GGAGGTGTGGACATGGGGCCGGG + Intergenic
930038497 2:47102791-47102813 GGAGAAGGGGACATGTACCCGGG - Intronic
933032404 2:77346495-77346517 TTACATGGGGACATGGACACTGG + Intronic
934278338 2:91590530-91590552 AGACATGTGGACAAGAACACTGG - Intergenic
935880329 2:107558743-107558765 GGACATGGGGACAGGGGCCATGG - Intergenic
936384094 2:112013123-112013145 GTACATGTGGGCATGGGGCCAGG - Intronic
938133839 2:128737670-128737692 GGAGGTGTGGGCATGGACCGGGG - Intergenic
940797769 2:158098591-158098613 GGAAATGAGCACATGGATCCAGG + Intronic
940838989 2:158557945-158557967 GGACACATGGACTTGGACCTTGG + Intronic
942659229 2:178246482-178246504 GGACATGGAGAGATGGCCCCTGG - Intronic
943376597 2:187085189-187085211 AGAAATGTGGATCTGGACCCTGG - Intergenic
944321929 2:198356136-198356158 GGCCTTGTGAACATGGAGCCTGG + Intronic
948132253 2:235609344-235609366 GGACATGGGGACATGGGGCAGGG + Intronic
948231998 2:236355567-236355589 GGACATGGGGAGAGGGACACAGG - Intronic
948466405 2:238153826-238153848 GGACATGAGCACATGGGGCCTGG - Intergenic
949052030 2:241902634-241902656 GGACCTGAGAACCTGGACCCAGG + Intergenic
1171204555 20:23268631-23268653 GGACATGTGGACAGAGCCACTGG - Intergenic
1172340621 20:34154642-34154664 GGAGAAGGGGACATGTACCCAGG - Intergenic
1172441620 20:34970381-34970403 GGACTAGTGGACATGGGACCAGG - Intergenic
1172693357 20:36805319-36805341 GGAAATGAGGGCATGGGCCCAGG - Intronic
1172776258 20:37408900-37408922 GGACAGATGGACACGGCCCCAGG - Intergenic
1173035138 20:39401722-39401744 GGTCATGTGGAGATGGAAGCAGG - Intergenic
1174088668 20:48028746-48028768 GGACAGGTGGACATGCAGCCTGG - Intergenic
1175764354 20:61582402-61582424 GGACTTGCGGACAGGGCCCCAGG - Intronic
1178105624 21:29316151-29316173 GAACATGTGATCATGGAACCAGG - Intronic
1178432519 21:32529137-32529159 TGCCATGGGGTCATGGACCCTGG - Intergenic
1179553805 21:42159992-42160014 GCCCATGTGGACTTGGACACAGG - Intergenic
1180593911 22:16961656-16961678 GGAAATGTGGCCAGGGGCCCTGG - Intergenic
1181555674 22:23670503-23670525 GGGCATGGGGGCATGGGCCCTGG - Intergenic
1183476950 22:38040894-38040916 GAACATGGGGGCAAGGACCCTGG + Intronic
1184335876 22:43852819-43852841 GGACATGCTGACAGAGACCCAGG + Intronic
950023541 3:9805822-9805844 GGCCAAGTGGAAAAGGACCCAGG - Intronic
952452995 3:33448856-33448878 GGAGAAGGGGACATGTACCCGGG - Intergenic
952465995 3:33586468-33586490 GGACATGTGGTCAGGAACACAGG + Intronic
953005792 3:38978149-38978171 GCAGATGTGGTCATGGATCCTGG - Intergenic
953561347 3:43995730-43995752 GGACACCTGCACATGGACCCGGG + Intergenic
954232301 3:49226862-49226884 GGAGAAGTGGACATGTACCTGGG + Intronic
954241301 3:49295885-49295907 GGCAATGTGGACCTGGAACCTGG - Intronic
954598896 3:51852378-51852400 GGAGAAGGGGACATGTACCCAGG - Intergenic
954880835 3:53835019-53835041 GGAAATGTTGACATGCTCCCAGG - Intronic
955043113 3:55335854-55335876 GGAGATGGGGCCAGGGACCCAGG + Intergenic
956425201 3:69127223-69127245 GGAGATGAGGACAGGGACCTAGG + Intergenic
957133882 3:76259762-76259784 GGAGGTGTGAACATGGGCCCAGG - Intronic
958549242 3:95593268-95593290 GGAGAAGGGGACATGTACCCAGG + Intergenic
960066058 3:113374417-113374439 GCACGTGTGCACATGTACCCTGG - Intronic
960726337 3:120674079-120674101 GGACCTGTGGAGATAAACCCAGG + Intronic
960898217 3:122528459-122528481 GTATTTGTGGACATGCACCCAGG - Exonic
962160244 3:132991522-132991544 GGACCTGAGGAAATGGACACAGG + Intergenic
962581849 3:136805046-136805068 GGAGATGTGGACATGCAGACTGG - Intergenic
963204177 3:142615589-142615611 GGCCATTTGGACACGGGCCCAGG - Intronic
965862841 3:173168108-173168130 AGACAGGTGTATATGGACCCTGG - Intergenic
966430450 3:179826603-179826625 GGACATGTAGACATGGGCAGAGG + Intronic
967093017 3:186151569-186151591 AGAAATGTGGTCATGGACACAGG + Intronic
967359211 3:188610386-188610408 GAACAAGTGGCCAAGGACCCAGG + Intronic
967873782 3:194252570-194252592 GAAGATGTGGACAAGAACCCAGG + Intergenic
969093827 4:4717614-4717636 GGACATGGGGACATGGGGACAGG - Intergenic
969471028 4:7389439-7389461 CCAGGTGTGGACATGGACCCTGG - Intronic
971281242 4:25244158-25244180 GGAGAAGGGGACATGTACCCAGG + Intronic
971395952 4:26227663-26227685 GGATATATGGTCATGTACCCTGG - Intronic
972745044 4:41924386-41924408 GGACATGTGGCAATGGCCCATGG - Intergenic
973045826 4:45533670-45533692 GGAGAAGAGGACATGTACCCAGG - Intergenic
974537097 4:63186850-63186872 GGAGAAGGGGACATGTACCCAGG - Intergenic
975509460 4:75177743-75177765 GGACATGTTGCAAAGGACCCAGG - Intergenic
978747136 4:112207671-112207693 GGAGAAGGGGACATGTACCCGGG - Intergenic
979877681 4:125913716-125913738 GGACATGTGTGCATTCACCCTGG - Intergenic
980290936 4:130846992-130847014 GGAGAAGGGGACATGTACCCAGG + Intergenic
981678078 4:147362592-147362614 GGACAGGAAGACATGGACCAGGG + Intergenic
982290550 4:153777816-153777838 GGAGATGTGTACATGCACCAGGG - Intergenic
982701085 4:158660203-158660225 GGAGAAGGGGACATGTACCCAGG - Intergenic
982877258 4:160664573-160664595 GGAGAAGGGGACATGTACCCTGG - Intergenic
984917407 4:184736657-184736679 GGAGAAGGGGACATGTACCCGGG - Intergenic
985869332 5:2541595-2541617 GCACATGTGAACATGCACACGGG - Intergenic
987441026 5:17956691-17956713 GGAAATGTGGACATGGATGCAGG - Intergenic
988357762 5:30199848-30199870 GGAGAAGGGGACATGTACCCAGG - Intergenic
988553500 5:32217325-32217347 GGCCATGGGGCCATGGAGCCTGG + Intergenic
989943165 5:50179359-50179381 GTGCATGTGCACATGGACACAGG - Intergenic
989957307 5:50372562-50372584 GGAGAAGGGGACATGCACCCAGG - Intergenic
989964407 5:50451361-50451383 GGAGAAGAGGACATGTACCCAGG + Intergenic
992049319 5:72928535-72928557 GGAGAAGGGGACATGTACCCGGG - Intergenic
992455157 5:76909721-76909743 GGAGAAGGGGACATGTACCCAGG - Intronic
992545730 5:77812235-77812257 GGAGAAGGGGACATGTACCCGGG - Intronic
992641705 5:78773553-78773575 GGACAGGAGGAGAAGGACCCAGG - Intergenic
993980788 5:94541195-94541217 GGACATGTGGAGTTAGACGCTGG + Intronic
995706396 5:114992609-114992631 GGAGAAGGGGACATGTACCCAGG - Intergenic
995840125 5:116436220-116436242 GGACATGAGTACATGAAACCTGG - Intergenic
996476442 5:123927805-123927827 GGACATGTGGAGCTAGACACTGG - Intergenic
997072359 5:130635821-130635843 GGAGAAGGGGACATGTACCCGGG - Intergenic
997242485 5:132318036-132318058 GGACATGGGGACATGGGTCAAGG + Intronic
997303704 5:132824048-132824070 GGCCATGTGGGCCTGGAACCAGG + Exonic
997613837 5:135232954-135232976 GGGCAGGTGGGCATGGAGCCAGG + Intronic
997692681 5:135837296-135837318 GGACAGGTGGTTCTGGACCCAGG + Intronic
998111418 5:139505560-139505582 GGAGAAGTGGACATGTACCCGGG - Intergenic
1000085180 5:157882244-157882266 GGAGAAGGGGACATGTACCCGGG - Intergenic
1001489176 5:172143581-172143603 GGAGATGTGGACATGGTCCTGGG + Intronic
1003402774 6:5804471-5804493 GGAGATGTGAACATGGACACTGG + Intergenic
1003706239 6:8534282-8534304 GGACATGGGGGCATGGGCTCTGG - Intergenic
1006405648 6:33843344-33843366 AGACATGTGAGCATGGCCCCAGG - Intergenic
1006449203 6:34096297-34096319 GGAGATGAGGTCATGGACTCTGG - Intronic
1008587043 6:52959821-52959843 GGAGAAGGGGACATGTACCCGGG + Intergenic
1009470754 6:64026849-64026871 GGAGAAGGGGACATGTACCCGGG - Intronic
1009740485 6:67737243-67737265 TGTCATGTGGACATGGGCCTTGG - Intergenic
1011375097 6:86679161-86679183 GGAGAAGGGGACATGTACCCGGG + Intergenic
1012441600 6:99266585-99266607 GGAGAAGGGGACATGTACCCAGG + Intergenic
1013255598 6:108381421-108381443 AGACATGTGCAAATGCACCCAGG - Intronic
1016055304 6:139572064-139572086 GGAAATGTGGGCATGCACACAGG + Intergenic
1016857187 6:148683160-148683182 GGAGATGTGGACCTGCTCCCTGG - Intergenic
1017111791 6:150939619-150939641 GGACTTGTGGACAGGGAAGCAGG - Intronic
1019611708 7:1940076-1940098 GGACATGCTGACCTGGACCAGGG + Intronic
1019746308 7:2702110-2702132 GGACAGATGGACAAGGACCAAGG - Intronic
1019829641 7:3314392-3314414 GGAAATGTGGACTTGGATCTTGG + Intronic
1021008380 7:15429368-15429390 GGACATGTGGACAAAGAAACAGG + Intronic
1021507892 7:21405369-21405391 CAGCATGTGGAAATGGACCCAGG - Intergenic
1023345087 7:39263790-39263812 TCACATCTGGACATGGACCATGG - Intronic
1024317454 7:48035238-48035260 GGACGTGGGGACGTGGACGCAGG - Intergenic
1024735232 7:52297040-52297062 GGAGAAGGGGACATGTACCCAGG - Intergenic
1024870839 7:53960464-53960486 GGAGAAGGGGACATGTACCCAGG + Intergenic
1025940295 7:66071965-66071987 GGACATGTACACAGGCACCCAGG - Intergenic
1033591956 7:142816367-142816389 AGAGATGTGGACATGGAAGCAGG + Intergenic
1033759303 7:144422696-144422718 GGAGAAGGGGACATGTACCCGGG + Intergenic
1034417223 7:150971505-150971527 GGACACAGGGACATGGAGCCAGG + Intronic
1035602425 8:904553-904575 GGACGTGTGGTCACTGACCCGGG + Intergenic
1036947507 8:13108170-13108192 GGACATGTGGACAAGAGCCCTGG + Intronic
1037697076 8:21232975-21232997 GGAGATGTGGACATTGGACCAGG + Intergenic
1037747513 8:21658812-21658834 GGACATGAGGACATTGACTCAGG - Intergenic
1038461727 8:27722884-27722906 GGACAAGTGGACCTGGTGCCGGG - Intergenic
1038638731 8:29307205-29307227 GGAGAAGGGGACATGTACCCGGG - Intergenic
1039275946 8:35934233-35934255 GGAGAAGGGGACATGTACCCGGG - Intergenic
1039999735 8:42565928-42565950 GGAGAAGGGGACATGTACCCGGG + Intergenic
1040527157 8:48235268-48235290 GGAGAAGGGGACATGTACCCAGG - Intergenic
1040530713 8:48264245-48264267 AGACATGTGGACCGGAACCCTGG + Intergenic
1040667928 8:49654778-49654800 GGAGAAGGGGACATGTACCCAGG + Intergenic
1040971518 8:53141329-53141351 GGAGAAGGGGACATGTACCCGGG + Intergenic
1041151726 8:54942758-54942780 GCACATGTAGACATGGAGCATGG - Intergenic
1045717643 8:105067202-105067224 GGACCTGTGCCCATGGACCTAGG - Intronic
1045858492 8:106790784-106790806 GGAGAAGGGGACATGTACCCAGG - Intergenic
1047972513 8:130097429-130097451 GGAGATGTGGGAAGGGACCCAGG - Intronic
1048121868 8:131590732-131590754 CTACATGAGGACATGGACCAAGG + Intergenic
1048793470 8:138126426-138126448 GGAGATGTGGACTTGAACTCTGG + Intergenic
1048968874 8:139633095-139633117 GGCCATGTGCACATAGACACAGG + Intronic
1051201706 9:14633719-14633741 GGGCATGTGAAAATGCACCCTGG - Intronic
1056392843 9:86155049-86155071 GGAGAAGGGGACATGTACCCGGG + Intergenic
1056926061 9:90835347-90835369 GGACAGCTGGACACGGGCCCAGG + Intronic
1057041413 9:91850532-91850554 GGACAAGGGGCCATGAACCCAGG + Intronic
1057221512 9:93260115-93260137 TGACATCAGGACATGGCCCCGGG - Intronic
1057252459 9:93514911-93514933 GGACAGCAGGACATGGAACCAGG - Intronic
1061777511 9:132975491-132975513 GGGCATTTGGAAATGGACCCAGG - Intronic
1062198386 9:135287208-135287230 GGACATGTGGGGATGGGCCTGGG + Intergenic
1186342645 X:8660259-8660281 GGACATGTGGACATTGTCTTTGG + Intronic
1190541397 X:51481845-51481867 GGACAAGGGGACATGTACCTGGG - Intergenic
1190777131 X:53561977-53561999 GCACATGTGGCCATGGCACCAGG - Intronic
1193923946 X:87463397-87463419 GGGCATGTGTACATGGAGGCAGG - Intergenic
1195552447 X:106184791-106184813 GGAGAAGGGGACATGTACCCAGG + Intronic
1196662006 X:118279695-118279717 GGAGAAGGGGACATGTACCCGGG + Intergenic
1197513343 X:127397237-127397259 GGAGAAGGGGACATGTACCCGGG - Intergenic
1200139577 X:153892664-153892686 AGATATGTGGACAGGAACCCAGG + Intronic
1200374862 X:155768705-155768727 AGACATGTGCACACGTACCCAGG - Intronic
1200940871 Y:8780279-8780301 GGACAGGAGGACAAGGACTCAGG - Intergenic
1200953902 Y:8926916-8926938 GGACAGGAGGACAAGGACTCAGG + Intergenic
1201989568 Y:20009259-20009281 GGAGAAGGGGACATGTACCCAGG + Intergenic
1202107600 Y:21386340-21386362 GGACAGGAGGACAAGGACTCAGG - Exonic
1202146747 Y:21806666-21806688 GGAGAAGGGGACATGTACCCAGG + Intergenic
1202183912 Y:22164310-22164332 GGACAGGAGGACAAGGACTCAGG - Intergenic
1202199348 Y:22330756-22330778 GGACAGGAGGACAAGGACTCAGG + Intronic
1202207447 Y:22422091-22422113 GGACAGGAGGACAAGGACTCAGG + Intergenic
1202232013 Y:22668299-22668321 GGACAGGAGGACAAGGACTCAGG + Intergenic
1202311143 Y:23527859-23527881 GGACAGGAGGACAAGGACTCAGG - Intergenic
1202559659 Y:26142735-26142757 GGACAGGAGGACAAGGACTCAGG + Intergenic