ID: 1072574244

View in Genome Browser
Species Human (GRCh38)
Location 10:96685731-96685753
Sequence CGGACCAGGACATGTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574244_1072574250 20 Left 1072574244 10:96685731-96685753 CCATGTCCACATGTCCTGGTCCG 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1072574250 10:96685774-96685796 AGAGTTAATTCTGACAACACAGG No data
1072574244_1072574251 21 Left 1072574244 10:96685731-96685753 CCATGTCCACATGTCCTGGTCCG 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574244_1072574246 -10 Left 1072574244 10:96685731-96685753 CCATGTCCACATGTCCTGGTCCG 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1072574246 10:96685744-96685766 TCCTGGTCCGATGCAGCAGTAGG No data
1072574244_1072574248 -9 Left 1072574244 10:96685731-96685753 CCATGTCCACATGTCCTGGTCCG 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1072574248 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574244 Original CRISPR CGGACCAGGACATGTGGACA TGG (reversed) Intronic
900302704 1:1985986-1986008 AGGTCCCGGCCATGTGGACACGG + Intronic
902934810 1:19757371-19757393 CAGAGCAGGACATGTGACCATGG - Intronic
904371484 1:30050249-30050271 AGGGCCAGGACATGGGGAGAGGG + Intergenic
906625728 1:47323880-47323902 AAGACCATGTCATGTGGACAGGG - Intergenic
908081926 1:60590086-60590108 AAGACCAGGACATGAGAACAAGG + Intergenic
908693524 1:66810170-66810192 CAGACCAGGACATGGGGATGTGG + Intergenic
921279083 1:213547959-213547981 TGCACCAGGACATGTGTACAAGG + Intergenic
921407747 1:214799556-214799578 GGGACCAGAACATGTGTACTTGG - Intergenic
922752529 1:228077246-228077268 CTGACCAGGGCATGGGGCCATGG - Intergenic
922983380 1:229847640-229847662 GGGACCAGGACGTGTGGGCTTGG + Intergenic
924060588 1:240170151-240170173 CCGACCAGAACCCGTGGACATGG + Intronic
1063554377 10:7064368-7064390 AGGACCAGGAGATGTGGATCAGG - Intergenic
1068596693 10:58909668-58909690 CTGAACAGTACATGTGGAAATGG - Intergenic
1070960865 10:80499405-80499427 CCAACCAGGGCAGGTGGACAAGG - Intronic
1072574244 10:96685731-96685753 CGGACCAGGACATGTGGACATGG - Intronic
1074942036 10:118245559-118245581 TGGACCAAGGCATGTTGACACGG - Intergenic
1075021684 10:118956868-118956890 GGGACCATGCCCTGTGGACATGG + Intergenic
1077537767 11:3132648-3132670 AGGACCGGGCCATGTGGAGATGG - Intronic
1081373199 11:42329263-42329285 TGGCCTAGGAAATGTGGACAAGG - Intergenic
1081720372 11:45284744-45284766 CCGACCACGACTTGTGGAGAAGG + Intronic
1083174914 11:60943590-60943612 AGGCCCAGGGCATGTGGAAAGGG - Intronic
1083428930 11:62603695-62603717 TGGAGCAGGACATGGGGAGAGGG - Intronic
1092953800 12:13531258-13531280 CGCTCCAGGACACGGGGACATGG + Intergenic
1093956575 12:25227299-25227321 GGGACCAGTACATGAGGACTGGG - Exonic
1103513825 12:121493805-121493827 AGGACCAGGACATGAGGAAGAGG - Intronic
1104965841 12:132508486-132508508 GGGTGCAGGACACGTGGACAGGG + Intronic
1108889940 13:55244835-55244857 AAGACTTGGACATGTGGACACGG + Intergenic
1114639723 14:24211405-24211427 CCTACCAGGACATGTGGGTACGG - Exonic
1120180546 14:81338430-81338452 CAGAGCAAGACATGTGGAAAGGG - Intronic
1121478869 14:94243433-94243455 CTAACAAGTACATGTGGACATGG - Intronic
1122519152 14:102330883-102330905 GGAAACAGGACATGAGGACAAGG + Intronic
1122862127 14:104587418-104587440 GTCCCCAGGACATGTGGACAGGG - Intronic
1127975686 15:63995669-63995691 AGGACCAGGTCAGGGGGACAAGG - Intronic
1129631702 15:77267253-77267275 AGGACCATCAGATGTGGACAGGG - Intronic
1134917171 16:18082699-18082721 GGGCCCAGGACATGTTGAGAGGG - Intergenic
1140599774 16:76461278-76461300 CTCAGCAGGAAATGTGGACAGGG + Intronic
1144326060 17:14181377-14181399 GGGACCAGGACCTTTGGCCAGGG - Intronic
1144474933 17:15578265-15578287 GGGACCAGGACCTTTGGCCAGGG - Intronic
1145894630 17:28447242-28447264 CGGACTAGGATATGTGGAGATGG + Intergenic
1146443211 17:32915206-32915228 TGGAACAGGACAGGTGGTCATGG - Intergenic
1146619369 17:34385699-34385721 CGGACAAGGAGCTGTGGGCATGG - Intergenic
1148695604 17:49556388-49556410 CGGAGAAGGACACGTGGACGAGG + Intergenic
1151596084 17:75078737-75078759 CGGAACAGGCCAGGTGGAGACGG - Intergenic
1152786109 17:82248919-82248941 CGGACGAGGAGATGTTGACGGGG + Exonic
1154349862 18:13573913-13573935 CTGACCAGGAAATGCGGAGATGG - Intronic
1156692605 18:39726526-39726548 AGGAGCAGGGCATGTGGCCAAGG - Intergenic
1160581289 18:79885820-79885842 GGGACGGGGACATGGGGACACGG + Intronic
1160581309 18:79885877-79885899 GGGACGGGGACATGGGGACACGG + Intronic
1160581328 18:79885933-79885955 GGGACAGGGACATGGGGACACGG + Intronic
1160581364 18:79886047-79886069 GGGACGGGGACATGGGGACACGG + Intronic
1160581384 18:79886104-79886126 GGGACGGGGACATGGGGACACGG + Intronic
1160581404 18:79886161-79886183 GGGACGGGGACATGGGGACACGG + Intronic
1160581424 18:79886218-79886240 GGGACGGGGACATGGGGACACGG + Intronic
1160581444 18:79886275-79886297 GGGACGGGGACATGGGGACACGG + Intronic
1160581464 18:79886332-79886354 GGGACGGGGACATGGGGACACGG + Intronic
1160581484 18:79886389-79886411 GGGACGGGGACATGGGGACACGG + Intronic
1160581520 18:79886495-79886517 GGGACGGGGACATGGGGACACGG + Intronic
1160581540 18:79886552-79886574 GGGACGGGGACATGGGGACACGG + Intronic
1160581560 18:79886609-79886631 GGGACGGGGACATGGGGACACGG + Intronic
1160581613 18:79886772-79886794 GGGACGGGGACATGGGGACACGG + Intronic
1160581633 18:79886829-79886851 GGGACGGGGACATGGGGACACGG + Intronic
1160581653 18:79886886-79886908 GGGACGGGGACATGGGGACACGG + Intronic
1160581689 18:79887000-79887022 GGGACAGGGACATGGGGACACGG + Intronic
1160581708 18:79887057-79887079 GGGACAGGGACATGGGGACACGG + Intronic
1160979774 19:1811652-1811674 CCCACCAGGACCTGGGGACACGG - Exonic
1161361259 19:3851125-3851147 CCGACCAAGACAGGTGGAGACGG + Intronic
1162036457 19:7942541-7942563 CGGCCCAGGAAATGTGGAAATGG - Intronic
1162480762 19:10925763-10925785 CGGTCCAGGACCTGGGGGCAAGG + Exonic
1162823646 19:13237883-13237905 CGGATCATAACATGTGGACTCGG + Intronic
1166094354 19:40530120-40530142 CTGGCCACCACATGTGGACAGGG - Intronic
1166272265 19:41721705-41721727 GGGACCGGGGCATGTGGAGAAGG + Intronic
1166437887 19:42785159-42785181 GGGGCCAGGGCATGTGGATAAGG - Intronic
1166456835 19:42948951-42948973 GGGGCCAGGGCATGTGGATAAGG - Intronic
1166466787 19:43039820-43039842 GGGACTAGGGCATGTGGATAAGG - Intronic
1166472924 19:43095898-43095920 GGGACTAGGGCATGTGGATAAGG - Intronic
1166486588 19:43219449-43219471 GGGGCCAGGGCATGTGGATAAGG - Intronic
1168129101 19:54306075-54306097 GGGTCCAGGACATGTGGGAAGGG - Intergenic
929430683 2:41883778-41883800 CAGACCAGGAAATGTGAAAAAGG + Intergenic
930583980 2:53248018-53248040 TGGTCCAGGACATGTTGCCAGGG + Intergenic
933783918 2:85823022-85823044 GGCACCAGGACATGTGAAGAAGG + Intergenic
938650252 2:133375638-133375660 AGGATGAGAACATGTGGACATGG - Intronic
948161692 2:235829945-235829967 GGGACCGGCACATCTGGACATGG + Intronic
1168763027 20:362633-362655 CGGCCCGGGACACGTGGTCAGGG + Intergenic
1171722558 20:28578926-28578948 TGAAGCAGGACAAGTGGACAAGG - Intergenic
1171755527 20:29104520-29104542 TGGAGGAGGACAAGTGGACAAGG + Intergenic
1173823333 20:46032082-46032104 CGGGCCAGGAGATGAGGGCAGGG - Intronic
1174036920 20:47674220-47674242 CGGGACGGGCCATGTGGACACGG - Intronic
1175943512 20:62548566-62548588 CGGACCAGGGCACGGGCACAGGG - Intergenic
1180296113 22:10937611-10937633 TGAAGCAGGACAAGTGGACAAGG - Intergenic
1180412565 22:12628400-12628422 TGGAGGAGGACAAGTGGACAAGG + Intergenic
1181616743 22:24060177-24060199 GGGACCAGGGCATGGGGACAGGG + Intronic
1183639943 22:39086742-39086764 CAGGCCAGGAGATGTGGACCTGG + Intronic
1184588029 22:45460822-45460844 AGGACCAGGACCTGTGCTCAAGG - Intergenic
1184608331 22:45586909-45586931 TGGGCCAGGCCATGTGGACAGGG + Intronic
1185252017 22:49807536-49807558 GGCACCAGGACAAGTGGATATGG + Intronic
952671174 3:35971328-35971350 AGGACCAGGACAAGGGGACAAGG - Intergenic
953543182 3:43840782-43840804 AGGACAAGGAGATATGGACAAGG - Intergenic
954124611 3:48521129-48521151 TGGACCAGGACATCTGGCCTTGG - Intronic
958482572 3:94662132-94662154 CAGAACAGCACATGTGGACTCGG - Intergenic
959131668 3:102363658-102363680 AGGCCCAGGACATGGGCACATGG - Intronic
959268436 3:104172562-104172584 TGGCCCAGGACCTGTGGCCATGG + Intergenic
960306574 3:116069238-116069260 AGAACTAGGACATGTGGAAAGGG - Intronic
961077796 3:123997953-123997975 AGGTCCAGGACATTTGGACAAGG - Intergenic
961306774 3:125963382-125963404 AGGTCCAGGACATTTGGACAAGG + Intergenic
962383901 3:134917352-134917374 CAGACCAGAGCATGGGGACATGG - Intronic
963215284 3:142739449-142739471 GGGAACAGGAGATGTGGAGAAGG + Intronic
967106865 3:186261223-186261245 CTGAACAGCACAGGTGGACAGGG - Intronic
968625682 4:1625701-1625723 CGTACCAGCCCATGTGGTCAGGG + Intronic
969111545 4:4847320-4847342 CGGCCCTGGAGATGTGGACCTGG - Intergenic
974950804 4:68581552-68581574 AGGACCAGGAGGTGTCGACAGGG - Intronic
974983455 4:68990299-68990321 CTGACAAGGAAATGAGGACAAGG + Intergenic
980836606 4:138201677-138201699 CAGATCAGGATTTGTGGACATGG - Intronic
986202319 5:5589697-5589719 CGCACCAGGACACTTTGACAAGG + Intergenic
990508478 5:56468333-56468355 CCGGCCAGGACCTGTGGCCAGGG - Intronic
998140354 5:139696644-139696666 CGGACCAGGCCAGGAGCACAGGG - Intergenic
1000658422 5:163910127-163910149 GGGACCAGGACATGTGTAGTGGG - Intergenic
1005320889 6:24652498-24652520 CAGACCTGGAGATCTGGACATGG + Intronic
1006165528 6:32062259-32062281 GGTGCCAGGACATGAGGACAGGG - Intronic
1006742096 6:36316234-36316256 CTGCCCAGAACATGTGGTCATGG - Exonic
1007092540 6:39193252-39193274 CTGGGCAGTACATGTGGACAAGG - Intronic
1008753916 6:54770784-54770806 AGGACCAGTACATGAGGACTGGG + Intergenic
1013018667 6:106186793-106186815 CTGAACAGGAAATGTGGACATGG + Intronic
1014137610 6:117907443-117907465 CGGGCCAGGACTTGGGGACGCGG + Intergenic
1019107979 6:169684541-169684563 AGGCCCAGGACATGGGAACAGGG - Intronic
1019586582 7:1808144-1808166 ATGCCCAGAACATGTGGACACGG - Intergenic
1019851123 7:3558546-3558568 TGGTACAGGCCATGTGGACAGGG + Intronic
1021971619 7:25970711-25970733 TGGACACGGACATGTGCACAGGG - Intergenic
1023056017 7:36290655-36290677 CTCACCAGGACTTGGGGACAGGG + Intronic
1026373460 7:69725557-69725579 TGGACCAAGACATGTGGACATGG + Intronic
1032189389 7:129755079-129755101 CGGACCAGTGCAGGTGGCCATGG + Exonic
1035069305 7:156129675-156129697 AGGACCAGGGCATGAGGACCAGG - Intergenic
1046442308 8:114273311-114273333 TGAACTAGGACATGTGGACTGGG + Intergenic
1050030728 9:1382570-1382592 CTGAAAAGGACATGTGGACCAGG + Intergenic
1052541543 9:29817188-29817210 TGGCCCAGGACATGGGCACAGGG - Intergenic
1056718573 9:89054187-89054209 AGGTCCAGGACATGTGGAGCAGG + Intronic
1059152595 9:111962929-111962951 CTGACCAGGAGATCAGGACATGG - Intergenic
1060927243 9:127463537-127463559 TGGACCCGGACATGTACACAGGG - Intronic
1061220408 9:129247285-129247307 GGGCCCAGGACAGGAGGACAAGG - Intergenic
1062253778 9:135611417-135611439 CAGAGCAGCAGATGTGGACAGGG - Intergenic
1202802963 9_KI270720v1_random:18638-18660 TGGAGGAGGACAAGTGGACAAGG - Intergenic
1185813564 X:3132613-3132635 AGGAGCAGGCCATGTGGAGACGG - Intergenic
1190582575 X:51903281-51903303 GGTATCTGGACATGTGGACAAGG + Intergenic
1193882240 X:86937157-86937179 CAGATCAGGACACATGGACACGG - Intergenic
1193978116 X:88148928-88148950 CGGAGCAGGACATCTGGGCCAGG - Intergenic
1196795975 X:119502319-119502341 AAGCCCAGGACATGTTGACAAGG + Intergenic
1197708871 X:129652489-129652511 GGGAGCAGGACATGTGTACCTGG + Intronic
1200870500 Y:8093139-8093161 CTGCCCAGGACATGAGTACAAGG - Intergenic