ID: 1072574245

View in Genome Browser
Species Human (GRCh38)
Location 10:96685737-96685759
Sequence CTGCATCGGACCAGGACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574245_1072574253 28 Left 1072574245 10:96685737-96685759 CCACATGTCCTGGTCCGATGCAG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1072574253 10:96685788-96685810 CAACACAGGGCAGAGCATGGAGG No data
1072574245_1072574251 15 Left 1072574245 10:96685737-96685759 CCACATGTCCTGGTCCGATGCAG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574245_1072574252 25 Left 1072574245 10:96685737-96685759 CCACATGTCCTGGTCCGATGCAG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1072574252 10:96685785-96685807 TGACAACACAGGGCAGAGCATGG No data
1072574245_1072574250 14 Left 1072574245 10:96685737-96685759 CCACATGTCCTGGTCCGATGCAG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1072574250 10:96685774-96685796 AGAGTTAATTCTGACAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574245 Original CRISPR CTGCATCGGACCAGGACATG TGG (reversed) Intronic
904237896 1:29125664-29125686 CTGCAGCGCACTAGGACACGGGG - Intergenic
907729317 1:57050432-57050454 CTCCATGGGAGCAGGAGATGAGG - Intronic
910526916 1:88190042-88190064 CTGCATGGAACCAAGACATTAGG + Intergenic
914801137 1:150963518-150963540 CTTCATTGGACCTGGACAGGAGG - Exonic
920248492 1:204606077-204606099 ATGCAATGGACCAGGCCATGTGG - Intergenic
920311046 1:205048450-205048472 CTGCAAGGCACCAGCACATGGGG - Intronic
1063205757 10:3829524-3829546 TTTGATAGGACCAGGACATGTGG + Intergenic
1063965663 10:11344202-11344224 CCGCATAGGCCCAGGACACGGGG + Intergenic
1064959086 10:20943670-20943692 TTGCATTGTAGCAGGACATGTGG - Intronic
1067852149 10:49761063-49761085 CTGCATCCCAGCAGGGCATGAGG + Intronic
1069747225 10:70723329-70723351 CTGGATGGGACCAGGACATTTGG + Intronic
1072574245 10:96685737-96685759 CTGCATCGGACCAGGACATGTGG - Intronic
1075221284 10:120587085-120587107 CAGGATCGGAACAGCACATGTGG + Intronic
1084257218 11:67951310-67951332 CTGCACCGTACCAGCGCATGAGG + Intergenic
1084815560 11:71643958-71643980 CTGCACCGCACCAGTGCATGAGG - Intergenic
1089276186 11:117337579-117337601 CTTAATAGGACCAGGATATGGGG - Intronic
1091680705 12:2524697-2524719 CTGCATCGGGCCAGCAGAAGAGG + Intronic
1094099240 12:26743600-26743622 CTGCACCTGGCCTGGACATGAGG - Intronic
1095702973 12:45209398-45209420 CTGCATTGCACCATGCCATGAGG + Intergenic
1095985405 12:47995920-47995942 CTGCATCGGAACAGAAAATGAGG + Intronic
1102205167 12:111085365-111085387 ATGCATCTGAGCAGGTCATGCGG + Intronic
1103513826 12:121493811-121493833 CGGGAAAGGACCAGGACATGAGG - Intronic
1110753119 13:79138819-79138841 CTGCTGTGGACGAGGACATGTGG - Intergenic
1112439732 13:99416952-99416974 CTGCAGCTCACCAGGCCATGGGG + Intergenic
1114063084 14:19037843-19037865 CTGCAGTGGTCCAGGGCATGCGG + Intergenic
1114099174 14:19362152-19362174 CTGCAGTGGTCCAGGGCATGCGG - Intergenic
1123493465 15:20800341-20800363 CTGCAGTGGTCCAGGGCATGCGG - Intergenic
1123549973 15:21369443-21369465 CTGCAGTGGTCCAGGGCATGCGG - Intergenic
1124227891 15:27911501-27911523 CTGCATCTGACGAGGACCTCCGG + Intronic
1125266878 15:37891887-37891909 CTGCATCAGAGCAGGGCATTTGG - Intergenic
1125740333 15:41958373-41958395 CCTCATCGGACCAGGACAAGGGG - Intronic
1128329094 15:66744310-66744332 CTGCCTCGGGCCAGGCCATCTGG + Intronic
1130024615 15:80260552-80260574 CTCCACTGGACCAGGGCATGGGG + Intergenic
1131093626 15:89642123-89642145 ATCCTTGGGACCAGGACATGTGG - Intronic
1202958303 15_KI270727v1_random:96661-96683 CTGCAGTGGTCCAGGGCATGCGG - Intergenic
1132800955 16:1752927-1752949 CTGCAGCTGAGCTGGACATGGGG - Intronic
1132882746 16:2169727-2169749 CTGCATGGAAGCAGCACATGGGG - Intronic
1133370797 16:5244282-5244304 CTGCACCGCACCAGTGCATGAGG - Intergenic
1139646036 16:68331110-68331132 GTGCCTAGGACCAGGATATGGGG - Intronic
1141066560 16:80918673-80918695 AGGCAGAGGACCAGGACATGAGG + Intergenic
1147920412 17:43913364-43913386 CTGCGTTGGTCCAGGACAAGCGG - Intergenic
1148885130 17:50766887-50766909 CTGAACCGGAACAGGACATCGGG - Intergenic
1151452056 17:74203912-74203934 CTGGCGCGGACCAGGACCTGCGG - Exonic
1152304900 17:79514721-79514743 CTGCATCCCCCCAGGCCATGTGG + Intronic
1152456809 17:80421572-80421594 CTGCTACGGACCAGGTCCTGGGG + Intronic
1154450994 18:14474801-14474823 CTGCAGTGGTCCAGGGCATGTGG - Intergenic
1155246908 18:23919609-23919631 CAGCATTTGAACAGGACATGGGG + Intronic
932275069 2:70445446-70445468 GTGCACCTGACCAGGACAAGGGG + Intergenic
932573832 2:72951951-72951973 GTGTGTCGGAACAGGACATGGGG - Intronic
938480439 2:131658006-131658028 CTGCAGTGGTCCAGGGCATGCGG + Intergenic
1169022503 20:2340341-2340363 CTCCATCAGAACAGGACAGGAGG + Intronic
1173838700 20:46142177-46142199 CTGGCTCGGACCAGGGCATGAGG - Intergenic
1175786155 20:61712812-61712834 CCGCATGGGCCCAGGGCATGGGG - Intronic
1176210794 20:63920341-63920363 CTGCGTCGGACCGGGAAGTGTGG + Intronic
1176445243 21:6815772-6815794 CTGCAGTGGTCCAGGGCATGTGG + Intergenic
1176823410 21:13680805-13680827 CTGCAGTGGTCCAGGGCATGTGG + Intergenic
1180127246 21:45800907-45800929 CTGCATCCTCCCAGGAGATGGGG + Intronic
1180481577 22:15760472-15760494 CTGCAGTGGTCCAGGGCATGCGG + Intergenic
1182236792 22:28883080-28883102 CTGCACCGGACCAGGACGCGTGG + Intergenic
1185159036 22:49211750-49211772 CTCCATCTGGCCAGGACAGGGGG + Intergenic
950750339 3:15123410-15123432 CTGCACCGTACCAGCGCATGAGG - Intergenic
957938415 3:86973655-86973677 GTCCATAGGACCAAGACATGGGG - Intronic
961482631 3:127193679-127193701 CTGCTTCGGACAAGGAAATCGGG + Intronic
962328309 3:134454452-134454474 CTGAATTGCACCAGGACGTGGGG - Intergenic
962344128 3:134607460-134607482 CTCCATCCGCCCAGGACAGGAGG - Intronic
981429400 4:144643173-144643195 CTGGATAGGACCAGGGTATGAGG + Intergenic
984503258 4:180583721-180583743 CTGTTTAGAACCAGGACATGAGG - Intergenic
989142367 5:38214397-38214419 CTGCATCTGAGCAGGAAATGTGG + Intergenic
989360683 5:40598040-40598062 CTGCAGTGGTCCAGGACAGGGGG + Intergenic
1003277987 6:4668625-4668647 CTGCATCGGAGCAGGCCCTGTGG + Intergenic
1009803871 6:68576566-68576588 TTGCACCGGAGAAGGACATGAGG + Intergenic
1019490290 7:1310051-1310073 CTGGATCGGACCAAGGCTTGAGG + Intergenic
1022982812 7:35620430-35620452 ATGCATAGAACCAAGACATGAGG + Intergenic
1029207862 7:98879592-98879614 CTCCATCGGCCCAAGGCATGGGG - Intronic
1032353838 7:131190842-131190864 CAACTTCAGACCAGGACATGGGG + Intronic
1032635597 7:133704609-133704631 CTGCATCTGGCCTGTACATGTGG + Intronic
1036243291 8:7096545-7096567 CTGCACCACACCAGTACATGAGG - Intergenic
1036898540 8:12654885-12654907 CTGCACCACACCAGTACATGAGG + Intergenic
1037736114 8:21567639-21567661 CTGCATATGACCAGCAAATGAGG + Intergenic
1038395280 8:27241831-27241853 CTGCTTCTAACCAGGACATTAGG + Intronic
1040415261 8:47189362-47189384 CTGCGTGGGCCCAGGACAGGCGG - Intergenic
1043204715 8:77422810-77422832 CTGCAAAGCACCAGGACATGTGG + Intergenic
1044947130 8:97399802-97399824 CAGCATTGGAGCAGGACCTGGGG - Intergenic
1047527747 8:125648105-125648127 CTTCTTTGGACCAGGACTTGTGG + Intergenic
1049269189 8:141685108-141685130 CTGCATGGGACCAGGGAAGGAGG + Intergenic
1055913967 9:81381074-81381096 CTGCAGCTGCCCAGCACATGTGG - Intergenic
1061724556 9:132575004-132575026 CTGCCTCGGCCCAGGTCCTGGGG - Intergenic
1062458808 9:136654299-136654321 CTGCAGGGGCCCAGGACACGGGG - Intergenic
1203523952 Un_GL000213v1:68753-68775 CTGCAGTGGTCCAGGGCATGTGG - Intergenic
1193978118 X:88148934-88148956 CTGCATCGGAGCAGGACATCTGG - Intergenic