ID: 1072574247

View in Genome Browser
Species Human (GRCh38)
Location 10:96685745-96685767
Sequence CCCTACTGCTGCATCGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574247_1072574254 30 Left 1072574247 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1072574254 10:96685798-96685820 CAGAGCATGGAGGCATCTTCAGG No data
1072574247_1072574252 17 Left 1072574247 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1072574252 10:96685785-96685807 TGACAACACAGGGCAGAGCATGG No data
1072574247_1072574251 7 Left 1072574247 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574247_1072574250 6 Left 1072574247 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1072574250 10:96685774-96685796 AGAGTTAATTCTGACAACACAGG No data
1072574247_1072574253 20 Left 1072574247 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1072574253 10:96685788-96685810 CAACACAGGGCAGAGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574247 Original CRISPR CCCTACTGCTGCATCGGACC AGG (reversed) Intronic
900438711 1:2643068-2643090 CCCTCCTGCTGCCATGGACCCGG - Intronic
900948243 1:5843359-5843381 CCCTCCTGCTCCATAGGACCAGG - Intergenic
902480830 1:16710679-16710701 ACATACTGCTGCATCAGAACAGG + Intergenic
903570065 1:24297729-24297751 CCCTGCTGCTGCTTCGGAGGAGG + Intergenic
905256767 1:36689739-36689761 CCCAACTGCTCCATGGGGCCTGG + Intergenic
923200147 1:231703593-231703615 CCCTGCTCCTGCTTAGGACCTGG + Intronic
1072503866 10:96044385-96044407 CCCTCCAGCTCCATGGGACCCGG - Exonic
1072574247 10:96685745-96685767 CCCTACTGCTGCATCGGACCAGG - Intronic
1073317865 10:102595543-102595565 CCCTACTAGTGCAAAGGACCAGG - Intronic
1073420083 10:103417700-103417722 CACTACTGCTGCAGAGGACTTGG - Intronic
1075923796 10:126234968-126234990 CCCACCTGCAGCATCAGACCTGG - Intronic
1080817204 11:35770211-35770233 CCATACTGCTGCAAAGGACATGG + Intronic
1080873974 11:36260148-36260170 CCCTAGTGCTGACTCGGGCCAGG - Intergenic
1080874403 11:36262947-36262969 CCCTAGTGCTGACTCGGGCCAGG - Intergenic
1083633788 11:64109374-64109396 CCCTACTGCTCCCCCAGACCTGG + Intronic
1093228445 12:16514042-16514064 TCCTTCTGCTGCTTGGGACCAGG - Intronic
1096807936 12:54151661-54151683 CCATACTGCTGCCCAGGACCAGG - Intergenic
1104634978 12:130432722-130432744 CCCTGCTGGTGCCTCGGCCCTGG + Intronic
1105303466 13:19154230-19154252 CCCAGCTGCTGCCTGGGACCTGG - Intergenic
1111577633 13:90177833-90177855 TCCTAATTCTGCTTCGGACCAGG + Intergenic
1112589632 13:100751324-100751346 CCCTCCTGCTCCATGGGGCCTGG + Intergenic
1129658706 15:77541437-77541459 CCCTCCTGCTGCCTCAGTCCAGG - Intergenic
1141446214 16:84060314-84060336 CCAGCCTGCTGCATGGGACCTGG + Intronic
1141461341 16:84180237-84180259 CCCGACTGCTGCCTCCGCCCCGG - Exonic
1146974294 17:37097840-37097862 CCCTTCTCCTGCATCCGGCCTGG + Exonic
1147369350 17:39980962-39980984 CCCTCCTGCTTCATGGCACCCGG - Exonic
1152183249 17:78838614-78838636 TCCTACTGCGGCATGGAACCAGG + Exonic
1152700135 17:81814553-81814575 CCCAACTTCTGCACAGGACCCGG + Intergenic
1155363577 18:25028537-25028559 CTATACTGCTGCATCCTACCTGG + Intergenic
1158940753 18:62404388-62404410 CTCTACTGCTCCAAAGGACCTGG + Intergenic
1160452975 18:78978558-78978580 CCCGCCTGCTCCATCGGACCCGG - Intergenic
1202714867 1_KI270714v1_random:36584-36606 ACATACTGCTGCATCAGAACAGG + Intergenic
925488863 2:4369274-4369296 GCCTACTGCAGCATCAGGCCAGG - Intergenic
929531418 2:42755401-42755423 CCCTTCTCCTGCTTCAGACCTGG - Exonic
931757328 2:65385581-65385603 CCCCACCGCTGTATCAGACCAGG - Intronic
931872924 2:66481106-66481128 CCCTCCTGCTGCAGGGGATCAGG - Intronic
934885540 2:98021248-98021270 CCCTCCGGCTTCATCTGACCAGG + Intergenic
942512696 2:176719018-176719040 CCCTACTGCTGCATGCTAACTGG - Intergenic
945181493 2:207096353-207096375 CCCTGTTGCTGCATCGCATCAGG + Intronic
1174417446 20:50376912-50376934 CCCTGCGGCTGCATCTGACAGGG - Intergenic
1175219370 20:57408178-57408200 CCCCACTGCTGCATCGTGGCGGG + Exonic
1181174244 22:21026984-21027006 CCCTCCTGCTGCCTGGGTCCTGG + Exonic
1182236790 22:28883072-28883094 CCTAACTCCTGCACCGGACCAGG + Intergenic
1183641850 22:39097517-39097539 CCCCACTGCTGCTTCTGAACGGG + Intronic
1184521004 22:44994093-44994115 ACCTGCTGCTGCGTCGGCCCGGG + Intronic
1185065614 22:48630405-48630427 CTCCACTGCTGCCTCGGCCCTGG + Intronic
954813137 3:53260219-53260241 CCCTAGTGCTGCACGGGTCCTGG - Intergenic
955333940 3:58069715-58069737 CCCTAACGCTGCAGCGAACCTGG - Intronic
967351548 3:188519260-188519282 CCCTTCTGCTGCATCCCATCAGG - Intronic
968503856 4:963099-963121 CCCTGCTGCTGCCCTGGACCAGG + Intronic
969682852 4:8652781-8652803 CCCTTCTGCTCCCTCAGACCCGG + Intergenic
979667342 4:123326737-123326759 CCCCACTGCTGCATGTGGCCAGG + Intergenic
980170386 4:129282448-129282470 CCCTAATTCTGCATCTGACATGG + Intergenic
989140271 5:38194982-38195004 CCTTACTGCTGCCTCTGTCCTGG + Intergenic
993549557 5:89256845-89256867 CCCTCTTCCTGCATCGGACTTGG - Intergenic
995099249 5:108278631-108278653 CCCTGCTGTTGCAGCTGACCTGG - Intronic
998016270 5:138734690-138734712 CTCTAATGCTCCATCTGACCAGG + Intronic
1005339539 6:24830490-24830512 CTCTACTGCTGCCTCATACCTGG + Exonic
1011522850 6:88228751-88228773 CCATACTGCTGCCTGGGACTGGG - Intergenic
1022220332 7:28307922-28307944 CCCTAATGATGCATGGGAGCTGG + Intronic
1037268613 8:17099114-17099136 TCGTACTGCTGCATCGGAGTGGG + Intronic
1039951857 8:42179271-42179293 CACTGCTGATGCTTCGGACCAGG + Intronic
1048223986 8:132567347-132567369 CCCGAATGCTGCAGTGGACCTGG - Intergenic
1048926718 8:139278152-139278174 CCCTCCTGCTGCACCTGCCCTGG - Intergenic
1049324990 8:142017126-142017148 CCCTCCTGCCACATGGGACCCGG - Intergenic
1049787645 8:144458708-144458730 CCCTCCTGCCCCATCTGACCAGG - Intronic