ID: 1072574249

View in Genome Browser
Species Human (GRCh38)
Location 10:96685751-96685773
Sequence TTAGTTCCCTACTGCTGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574249_1072574253 14 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574253 10:96685788-96685810 CAACACAGGGCAGAGCATGGAGG No data
1072574249_1072574250 0 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574250 10:96685774-96685796 AGAGTTAATTCTGACAACACAGG No data
1072574249_1072574251 1 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574249_1072574255 25 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574255 10:96685799-96685821 AGAGCATGGAGGCATCTTCAGGG No data
1072574249_1072574254 24 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574254 10:96685798-96685820 CAGAGCATGGAGGCATCTTCAGG No data
1072574249_1072574252 11 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574252 10:96685785-96685807 TGACAACACAGGGCAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574249 Original CRISPR TTAGTTCCCTACTGCTGCAT CGG (reversed) Intronic
903188318 1:21641918-21641940 TTTCTTCCCTCCTGCAGCATGGG + Intronic
904198562 1:28804247-28804269 TTAGAACCCTACTGCTGCCATGG - Intergenic
906172186 1:43735757-43735779 TTCGTTCTCTACTGCTGCTGTGG - Intronic
908093041 1:60706785-60706807 TGAGATTCCTACTGCTGCAATGG - Intergenic
909320590 1:74280661-74280683 TCAGGTTCCTACTGCTGCAGTGG - Intronic
918378889 1:183935294-183935316 TAAGGTCCCTACTGCTGTGTGGG - Intronic
919612002 1:199756961-199756983 TTTGTTTGCTACTGATGCATTGG + Intergenic
1072574249 10:96685751-96685773 TTAGTTCCCTACTGCTGCATCGG - Intronic
1073366526 10:102947174-102947196 TCATTTTCCTACTGCTTCATAGG + Intronic
1074817989 10:117157729-117157751 TCATTTCCCTACTGATGGATTGG - Intergenic
1081146276 11:39564955-39564977 TTATTTCCATATTGCAGCATAGG - Intergenic
1082883326 11:58059358-58059380 TTATTTTCCTTCTGCTGCTTTGG - Intronic
1082971943 11:59031909-59031931 TTGGTTCCTTATTGCTGGATGGG - Intronic
1082975988 11:59072119-59072141 TTGGTTCCTTATTGCTGGATGGG - Intergenic
1083559086 11:63657503-63657525 TTACTTCCTTACTCCTGTATGGG - Intronic
1087078607 11:94149060-94149082 TTAGTTCCCTTCTCCTGCCTAGG + Intronic
1087665203 11:101037200-101037222 TTAGTACCTTTGTGCTGCATGGG + Exonic
1088401860 11:109430121-109430143 TTAGTTTCCTGCTTCTGCAATGG + Intergenic
1089528402 11:119111559-119111581 TTGGTCCACTTCTGCTGCATGGG - Exonic
1090108135 11:123873929-123873951 TTTTTTCCATCCTGCTGCATGGG - Intergenic
1095148390 12:38759859-38759881 TCTCTTCCCTTCTGCTGCATTGG - Intronic
1096445476 12:51686948-51686970 TCACTTCCTTCCTGCTGCATTGG + Intronic
1096518506 12:52171344-52171366 TTAAGTCCCTCCTGCTGCAGTGG + Exonic
1096913351 12:55006274-55006296 TTGGTTCTCTATTCCTGCATTGG + Intergenic
1098032432 12:66268278-66268300 TTAGTTTCTTTCTGCTGCTTAGG + Intergenic
1101248062 12:102903577-102903599 TTTGTGCCCTACTCCTGCCTAGG - Intronic
1102437408 12:112936094-112936116 CCACTTCCCAACTGCTGCATTGG + Intergenic
1103820554 12:123694465-123694487 CTAGTTCCCTACTACGGCGTAGG - Intronic
1105649933 13:22365585-22365607 TTAGTTTCATTCTTCTGCATAGG - Intergenic
1107844584 13:44498360-44498382 TAAGTTCTCTACTTCTGCCTGGG + Intronic
1120133700 14:80838311-80838333 TTAGTTATCTTCTGCTCCATTGG - Intronic
1120801643 14:88696073-88696095 TTAGTTCCTCACTGCTCCAGTGG + Intronic
1126708206 15:51427398-51427420 TTAGTTCCCTCATGCAGCAGAGG + Intergenic
1131704134 15:94974435-94974457 TTAGGTCCCTAATGCTGCACCGG - Intergenic
1138468879 16:57215463-57215485 TGCTTTCCCTACTGCTACATTGG - Intronic
1138504526 16:57471389-57471411 TTGGTTCCCTACAGGTGCACTGG - Exonic
1139168848 16:64605525-64605547 TTTTTTTCCTACTGCTGCTTTGG - Intergenic
1143071000 17:4293148-4293170 GTGGTTCCCTACTGCTGGAGGGG - Intronic
1148889432 17:50797363-50797385 TTCGTTCCCTTCTGCTTCATAGG + Intergenic
1151344289 17:73492265-73492287 TCAGCTACCTACTGCTGCTTAGG - Intronic
1152512267 17:80798457-80798479 TTAGTTGCCTGCTCCTGCTTGGG + Intronic
1153401882 18:4690870-4690892 TTCTCTCCCTATTGCTGCATGGG - Intergenic
1155077229 18:22369677-22369699 CTAGTTCTCTACTGCTGGAACGG + Intergenic
1158078791 18:53563902-53563924 TTAGTTCACTGCTGCTAGATCGG - Intergenic
1162925103 19:13926906-13926928 TTATGTCCCTTCTGCTGCAAGGG - Intronic
1164722259 19:30441121-30441143 TTCTTTCCCTCCTGCTGAATTGG + Intronic
926743941 2:16135312-16135334 TCAGTCTCCTACTGCTGCAGTGG + Intergenic
933112887 2:78426547-78426569 TGAGTTCCCTACTTCTCTATAGG - Intergenic
939257360 2:139760750-139760772 TTAGTACCCTACTCCTGCAAAGG - Intergenic
945671614 2:212809123-212809145 TTAGTTTCCTACTTCTGGAAGGG - Intergenic
1169697370 20:8405490-8405512 CTATTTCCCTACTGCTAAATCGG - Intronic
1170496124 20:16927190-16927212 TTAGTTAACTAATGCTGCAGAGG + Intergenic
1171159190 20:22906235-22906257 TCACTTCCCCACTCCTGCATGGG + Intergenic
1173547879 20:43913686-43913708 TTAGTTCTCAACTGCTGCTTGGG - Intergenic
1174125726 20:48304221-48304243 CTAGTTGCCTACTGCTGTGTGGG + Intergenic
1174755360 20:53153115-53153137 TTGGTTCCATGCGGCTGCATAGG - Intronic
1177606745 21:23389291-23389313 TCAACTCCTTACTGCTGCATTGG - Intergenic
1179836153 21:44034910-44034932 TTAGTTCCCTCTGGCTGCAGTGG - Intronic
1183754303 22:39745561-39745583 TCATGTCCCTGCTGCTGCATCGG - Intronic
951109874 3:18790338-18790360 TTCTTTCCCTACTCCTACATGGG + Intergenic
953465855 3:43118866-43118888 TTGGGTCCCTAGTTCTGCATGGG + Intergenic
955802828 3:62703827-62703849 TTATGTGCCGACTGCTGCATTGG - Intronic
960162465 3:114365388-114365410 TTAGTGCCCTCCTGCTGGAAGGG - Intronic
962870950 3:139492353-139492375 TTAGTTTCCAACTGCTGGAATGG + Intergenic
963021520 3:140876654-140876676 TTCTTTCCATACTGCAGCATGGG - Intergenic
965381821 3:167998653-167998675 TTAGTTTCCTAGGGCTGCCTGGG - Intergenic
970706478 4:18810092-18810114 TTAGTTCTTTTCTGTTGCATTGG + Intergenic
971933644 4:33118385-33118407 TTACATCCCTACTGCTACAGAGG - Intergenic
974737334 4:65953652-65953674 TTATTTCCCTAATGCTAGATGGG + Intergenic
976535001 4:86202680-86202702 TCAGTTCTCTACTGCTGAAGTGG + Intronic
982196245 4:152918317-152918339 TTAGTTCACTACTAGTGAATGGG - Intronic
985591767 5:769362-769384 TCAGTTCCCAACCGCTGCCTCGG + Intergenic
985609682 5:880321-880343 TCAGTTCCCAACCGCTGCCTCGG + Intronic
987832269 5:23110377-23110399 TTAGTTTCATTCTTCTGCATAGG - Intergenic
988358168 5:30202861-30202883 TTCTTTCCATACTGCAGCATGGG - Intergenic
988914169 5:35875723-35875745 TCAGTTCCCTACTGCAGCTAGGG - Intronic
988955771 5:36316825-36316847 CTAGTTTCCTTCTTCTGCATAGG + Intergenic
990324936 5:54665830-54665852 TTAGTTTCCTATTGCTGCCATGG - Intergenic
993138272 5:83997964-83997986 TCAGGTTCCTACTGCTGGATGGG - Intronic
995126128 5:108578310-108578332 TTCTTTCCATATTGCTGCATGGG + Intergenic
995651062 5:114368844-114368866 ATAGGTCCCTACTGCTGCTGAGG - Intronic
1004517369 6:16331649-16331671 TTTCTTCCCTAGTGCTGCCTTGG - Intronic
1004843305 6:19612026-19612048 TGAGTTTCCTCCTGCTGCTTTGG - Intergenic
1010261304 6:73820237-73820259 TTAGTTCCATTTTGCTGAATGGG - Intronic
1013448481 6:110255447-110255469 TTAGTTCTTTGCTGTTGCATAGG - Intronic
1015515181 6:134076362-134076384 TTATTTCCCTACAGCTACAATGG + Intergenic
1020785405 7:12567389-12567411 TAAGTTTCTTAGTGCTGCATGGG + Intergenic
1024129540 7:46336556-46336578 TTTTTTCCATCCTGCTGCATGGG - Intergenic
1024821719 7:53338513-53338535 TTAGTTCCCTCATGCAGCAGAGG - Intergenic
1027555968 7:79665158-79665180 CTAGCACCCTTCTGCTGCATTGG - Intergenic
1028012692 7:85668389-85668411 ATAGTTCATTACTGCTGCAAAGG - Intergenic
1028588241 7:92471818-92471840 TTCTTTCCATATTGCTGCATGGG + Intronic
1029864904 7:103617752-103617774 TTTGTTCCCTAATGCTGAAGAGG + Intronic
1032836719 7:135681802-135681824 TTAGTTCCCAGTTGCTGCCTGGG + Intronic
1033054101 7:138033915-138033937 TTAGTTCCCTCATGCAGCAGAGG - Intronic
1033754534 7:144387222-144387244 CTATTTCCCTACTGCTGTTTTGG + Intergenic
1039083032 8:33752679-33752701 TTAGTTCCTTTCTTCTGCTTGGG + Intergenic
1040796464 8:51294022-51294044 TTCTTTCCCTATTGCAGCATGGG + Intergenic
1041888669 8:62843746-62843768 TTAGTTCCCTATTGTTGCTGTGG - Intronic
1041959740 8:63598999-63599021 TATGTTCCCAAATGCTGCATGGG + Intergenic
1042782532 8:72508050-72508072 ATAATTCCCTTCTGCTTCATGGG + Intergenic
1043206326 8:77447400-77447422 ATAGTTCCATAGTGCTCCATAGG - Intergenic
1043887799 8:85622634-85622656 TTACTTCCATACTTCTGCATTGG - Intergenic
1053134523 9:35641904-35641926 TTCTCTCCATACTGCTGCATGGG + Intronic
1053389685 9:37725373-37725395 TTTGTCCCCTATAGCTGCATTGG - Intronic
1188516290 X:30990241-30990263 TTAGTTTACTACTGCTGCTGTGG + Intergenic
1195439942 X:104888004-104888026 TTATTTCCATATTGCAGCATGGG - Intronic
1196325888 X:114402121-114402143 TTATTTCCCTATTGCTGATTAGG - Intergenic