ID: 1072574251

View in Genome Browser
Species Human (GRCh38)
Location 10:96685775-96685797
Sequence GAGTTAATTCTGACAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574242_1072574251 28 Left 1072574242 10:96685724-96685746 CCAGGGTCCATGTCCACATGTCC 0: 1
1: 0
2: 0
3: 19
4: 291
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574245_1072574251 15 Left 1072574245 10:96685737-96685759 CCACATGTCCTGGTCCGATGCAG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574249_1072574251 1 Left 1072574249 10:96685751-96685773 CCGATGCAGCAGTAGGGAACTAA 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574244_1072574251 21 Left 1072574244 10:96685731-96685753 CCATGTCCACATGTCCTGGTCCG 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data
1072574247_1072574251 7 Left 1072574247 10:96685745-96685767 CCTGGTCCGATGCAGCAGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574251 Original CRISPR GAGTTAATTCTGACAACACA GGG Intronic
No off target data available for this crispr