ID: 1072574572

View in Genome Browser
Species Human (GRCh38)
Location 10:96688195-96688217
Sequence GGGGAATGACATTGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072574572_1072574578 -4 Left 1072574572 10:96688195-96688217 CCTCCCAGCCAATGTCATTCCCC 0: 1
1: 0
2: 2
3: 26
4: 349
Right 1072574578 10:96688214-96688236 CCCCACCCAGGATGAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072574572 Original CRISPR GGGGAATGACATTGGCTGGG AGG (reversed) Intronic
900080125 1:850389-850411 GGGGGATGACATTTGCTGACTGG - Intergenic
900411056 1:2512904-2512926 GGGGAATGTCTTCGACTGGGGGG - Exonic
900886357 1:5418229-5418251 GGTGAACGGGATTGGCTGGGAGG + Intergenic
902089226 1:13890019-13890041 GTGGAATGCCATAGACTGGGTGG + Intergenic
902172858 1:14627137-14627159 GGGAAATCAGAGTGGCTGGGGGG + Intronic
902197663 1:14809774-14809796 GGGAGATGGCAGTGGCTGGGAGG + Intronic
902289386 1:15426652-15426674 GGGGAGTGCGAGTGGCTGGGCGG + Intronic
902361544 1:15944893-15944915 GGGGAGGGACGCTGGCTGGGAGG + Intronic
902646755 1:17804936-17804958 GGAGAATGACACTGGCTGCTGGG - Intronic
903438760 1:23371329-23371351 GTGGAAGGACAGTGGCTGAGGGG + Exonic
905464773 1:38144609-38144631 GGAGAAAGACACAGGCTGGGAGG - Intergenic
905775090 1:40663298-40663320 GGCCCATGACATTGACTGGGGGG + Intronic
905890555 1:41516163-41516185 AGGGAATGCCCCTGGCTGGGCGG + Intronic
907316045 1:53573336-53573358 GGGGAAGGACAGTGGCGGTGGGG + Intronic
908381044 1:63597048-63597070 TGGGAAAGACATAGTCTGGGAGG + Intronic
909024605 1:70468090-70468112 GGGCATTGTCATGGGCTGGGGGG - Intergenic
910208591 1:84772264-84772286 ATGGAATGAGATTGACTGGGAGG + Intergenic
910831823 1:91469072-91469094 GGAGAAAGACAGAGGCTGGGAGG + Intergenic
912185384 1:107268920-107268942 GGGAGATGACAATGGCTTGGAGG - Intronic
912493529 1:110076410-110076432 GACGAGTGACATGGGCTGGGCGG + Intergenic
912944287 1:114071744-114071766 GGAGAAAGACATAGGCTGGGAGG + Intergenic
913392070 1:118325195-118325217 GGAGAAAGATATAGGCTGGGAGG + Intergenic
917005113 1:170406494-170406516 GGAGAAAGACGTAGGCTGGGAGG - Intergenic
917603141 1:176597523-176597545 GGGGTCTGTCATGGGCTGGGGGG + Intronic
918180443 1:182082299-182082321 GGTGAATGAAACTGTCTGGGTGG - Intergenic
918957839 1:191234357-191234379 GGAGAAAGATATAGGCTGGGAGG - Intergenic
919685552 1:200480008-200480030 GGAGAATGGCCTGGGCTGGGAGG - Intergenic
922203970 1:223430776-223430798 GTGGAATGAAATGGGCTGAGAGG + Intergenic
924652643 1:245944017-245944039 TCAGTATGACATTGGCTGGGTGG - Intronic
1062957367 10:1549141-1549163 GGGGAATCACTTTAGCTGGGGGG + Intronic
1064267615 10:13837604-13837626 GAGTAATGACATTGCCTGAGTGG - Intronic
1065680476 10:28226215-28226237 GGTGATTGACATGGGCTGGAGGG + Intronic
1066298844 10:34079354-34079376 TGGGAATGACTCTGTCTGGGAGG + Intergenic
1066932158 10:41776290-41776312 GGGGACTGACGTGGGGTGGGAGG + Intergenic
1067175539 10:43943346-43943368 GGGGCATGAGGGTGGCTGGGTGG + Intergenic
1067298251 10:44988102-44988124 GAGGAGTCACATTCGCTGGGAGG + Intronic
1068700434 10:60014267-60014289 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1069568947 10:69482776-69482798 GGGAAATGCCACTGGCTGGAGGG - Intronic
1070967715 10:80539684-80539706 GAGGAATGACAATGACAGGGTGG - Intronic
1072574572 10:96688195-96688217 GGGGAATGACATTGGCTGGGAGG - Intronic
1073125283 10:101145507-101145529 GGGGGATGGGATTGTCTGGGTGG + Intergenic
1074087780 10:110221811-110221833 GGGAAAGGACATGGGGTGGGGGG - Intronic
1074224462 10:111470431-111470453 GGGGCAGGACATAGGCTTGGGGG - Intergenic
1074491450 10:113942984-113943006 GGAGAATGATGTAGGCTGGGAGG + Intergenic
1075562546 10:123478853-123478875 TAGGAATGACCTAGGCTGGGTGG + Intergenic
1076292842 10:129361040-129361062 GGGGGATCACATGAGCTGGGGGG + Intergenic
1076302033 10:129435784-129435806 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1077184299 11:1229422-1229444 TGGGAAGGGCACTGGCTGGGAGG + Intronic
1077460276 11:2705635-2705657 GGGGATTGTTCTTGGCTGGGGGG - Intronic
1078782384 11:14451568-14451590 GGAGAAAGATATAGGCTGGGAGG - Intronic
1079193749 11:18305439-18305461 GGGGAAAGACAAAGACTGGGAGG + Exonic
1079448699 11:20580627-20580649 GGGGCATGACATTGGTGGGAGGG + Intergenic
1080362704 11:31534163-31534185 GTGGAATGACATTAGCATGGAGG + Intronic
1081522483 11:43896457-43896479 GGAGAACGACGTAGGCTGGGAGG + Intronic
1081929931 11:46862289-46862311 GGGGAATGACAGTTCCTGGAGGG + Intronic
1082777510 11:57258734-57258756 GGGGAATGACAGACACTGGGTGG + Intergenic
1085525791 11:77162775-77162797 GGGCAAAGACATGGGCAGGGAGG + Intronic
1085685501 11:78618704-78618726 AGAGAAGGACATAGGCTGGGAGG - Intergenic
1090571814 11:128055562-128055584 AGGGACTGACATTGGGTGTGGGG - Intergenic
1091189694 11:133680794-133680816 GGAGAAAGATGTTGGCTGGGAGG - Intergenic
1093718052 12:22406010-22406032 GGGGACTGTCATGGGGTGGGGGG + Intronic
1095297126 12:40539728-40539750 GGGGCCTGTCATTGGGTGGGAGG - Intronic
1095314067 12:40737524-40737546 GGAGAAAGACGTAGGCTGGGAGG + Intronic
1095350313 12:41202474-41202496 GGTGACTGACATGGGTTGGGTGG + Intronic
1095536515 12:43254677-43254699 AGGGAACAACATTTGCTGGGGGG + Intergenic
1095567368 12:43641282-43641304 GGGGCCTGTCAGTGGCTGGGGGG - Intergenic
1095693469 12:45117520-45117542 GAGGAATGAGATTGGATTGGAGG - Intergenic
1096447556 12:51707470-51707492 GGGGAAAGATGTAGGCTGGGAGG + Intronic
1096786171 12:54018363-54018385 GGGGAAGGCCCTAGGCTGGGCGG + Intronic
1097890387 12:64771857-64771879 GGTGAATGGCATTGGCTGACTGG + Intergenic
1098805017 12:75012664-75012686 GGAGAAAGATATAGGCTGGGAGG - Intergenic
1099377320 12:81907350-81907372 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1099456303 12:82866615-82866637 GGGGAATCAAATTGACTGAGGGG + Intronic
1100082889 12:90874673-90874695 GGAGAAAGATATAGGCTGGGAGG - Intergenic
1100241614 12:92715210-92715232 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1101543868 12:105691151-105691173 AATGAATGAAATTGGCTGGGTGG - Intergenic
1101725707 12:107386540-107386562 GGATAATGACATTGGCCTGGAGG + Intronic
1102395585 12:112583071-112583093 GAGGGAGGACAGTGGCTGGGAGG + Intronic
1104043881 12:125147921-125147943 GGAGAAAGACGTAGGCTGGGAGG - Intergenic
1104806463 12:131592419-131592441 GGGGAGTGGGATTGGCTGGATGG - Intergenic
1105042314 12:132970144-132970166 GGAGAAAGACATAGGCTGAGAGG - Intergenic
1105279910 13:18957503-18957525 GGAGAATGCCATTGGAGGGGAGG - Intergenic
1105349281 13:19601674-19601696 TGGGAATGTCAGTGGTTGGGAGG - Intergenic
1107043028 13:35968894-35968916 GGAGAATGCCATGGGTTGGGAGG - Intronic
1107456938 13:40563707-40563729 GGGGAATGCAATAGGATGGGAGG - Intronic
1107709621 13:43138914-43138936 AGGGACAGACATTGGCTGAGAGG + Intergenic
1108597111 13:51959101-51959123 GGGGAATGAGATTGGGCGGGAGG + Intronic
1108927712 13:55773844-55773866 GGAGAAAGATATAGGCTGGGAGG - Intergenic
1112249621 13:97767765-97767787 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1113049585 13:106195375-106195397 GGGAAATGACAATAGCGGGGTGG + Intergenic
1114543791 14:23483475-23483497 GAGGAATGATGTTGGCCGGGAGG - Intronic
1116270657 14:42761037-42761059 GGAGAAAGACATAGGCTGGGAGG + Intergenic
1116474129 14:45320394-45320416 GGGGCATGTCGTGGGCTGGGGGG - Intergenic
1116685968 14:48039092-48039114 GGAGAAAGATATAGGCTGGGAGG - Intergenic
1117342491 14:54804286-54804308 GGGGAGGGACATTGGCCGGATGG - Intergenic
1120967367 14:90179606-90179628 GGCGAATGAGATTGGCTTGGAGG - Intronic
1124104353 15:26723599-26723621 GGACAATGACCATGGCTGGGAGG - Intronic
1124233674 15:27968343-27968365 GGGGAATGACAGGGGCAGGGTGG + Intronic
1125996274 15:44164150-44164172 GGGGATAGACATTGTCTGGAAGG - Intronic
1126410762 15:48370724-48370746 GGGGGATGACTTAGGCTGAGTGG + Intergenic
1127167859 15:56266478-56266500 GGGGCCTGTCATTGGGTGGGGGG - Intronic
1127577385 15:60305012-60305034 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1127896762 15:63307173-63307195 GGGGAGTGACAGTGGCAGGACGG + Exonic
1128481023 15:68038360-68038382 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1128557971 15:68644650-68644672 AGGGGATGACAGTGGATGGGGGG + Intronic
1129444587 15:75608024-75608046 GGGGAAAGACATGGGATGGGTGG + Intronic
1129741303 15:77990949-77990971 TGGGGATGACAGTGGCTGTGGGG - Intronic
1129844361 15:78761450-78761472 TGGGGATGACAGTGGCTGTGGGG + Intronic
1130012309 15:80161140-80161162 GGGGAGTGAGAGGGGCTGGGAGG - Intronic
1130154981 15:81342763-81342785 CAGGAATGCCATGGGCTGGGAGG + Intronic
1130253697 15:82316170-82316192 GTGAGATGAGATTGGCTGGGAGG + Intergenic
1130257439 15:82332329-82332351 GGGGGATGACAGTGGCTTTGCGG - Intergenic
1131826339 15:96324641-96324663 GAGGAATGAGATGGGCAGGGAGG + Intergenic
1132151678 15:99466719-99466741 GGGTAAGGGAATTGGCTGGGAGG + Intergenic
1132236234 15:100223981-100224003 GGAGAAAGACGTAGGCTGGGAGG + Intronic
1132306129 15:100814148-100814170 GTGTAATGACATTGGCTGGTTGG - Intergenic
1132335559 15:101046220-101046242 GGGGAATGCCCTTTGCTGGGGGG + Intronic
1133195377 16:4166300-4166322 GGGAAAGGACATTGACTGGGAGG + Intergenic
1135502411 16:23008083-23008105 GGGGAAAGATTATGGCTGGGTGG + Intergenic
1136591888 16:31222768-31222790 GGGGGAGGACAAGGGCTGGGGGG - Intronic
1137735947 16:50723307-50723329 GGGGAACAACATTGGCAGTGTGG + Exonic
1138333917 16:56237232-56237254 GAGTAATGACATTAGCTGGTGGG + Intronic
1138929980 16:61641547-61641569 GGTGAATTACATTGGCATGGAGG + Intergenic
1142161514 16:88560146-88560168 AGGGAGGGACAGTGGCTGGGAGG - Intergenic
1143108850 17:4542538-4542560 GGGGAGTGACAAGGGCTGTGAGG + Intronic
1143171832 17:4934744-4934766 GGGTAATGACATGGACTTGGCGG + Exonic
1144304452 17:13955392-13955414 GGAGAAAGATGTTGGCTGGGAGG - Intergenic
1146512342 17:33460945-33460967 GGGCAATGAAATTGGCTGGATGG - Intronic
1147369824 17:39984693-39984715 GGGAAATGAGTTTGGCTGGGAGG - Intronic
1147605461 17:41771637-41771659 GGGTCCTGACCTTGGCTGGGGGG + Exonic
1147702406 17:42404322-42404344 GCGGAATGACAGCAGCTGGGTGG + Exonic
1148179695 17:45595361-45595383 GGAGAAAGATGTTGGCTGGGAGG + Intergenic
1148619983 17:49027112-49027134 GGGGAAATACATTGGATTGGGGG + Intronic
1148890802 17:50805828-50805850 GGGGAATGACATGGGGTGGGGGG + Intergenic
1149655092 17:58305780-58305802 GGGGAAGGAGATAGGGTGGGTGG - Intronic
1150148009 17:62786371-62786393 GGGGCATGTCATGGGGTGGGGGG + Intronic
1151548374 17:74807116-74807138 TGGGGATGACACTGGCGGGGTGG - Intronic
1155878206 18:31112466-31112488 GGAGGATGACATTGAATGGGAGG - Intergenic
1156930242 18:42633010-42633032 GGGGAAGTACAGTGGCTGTGTGG - Intergenic
1157142820 18:45128018-45128040 GGGGTCTGTCATTGGGTGGGGGG - Intergenic
1157585787 18:48800427-48800449 GGGGAATGTGATGGGCTGGCTGG - Intronic
1159819483 18:73121642-73121664 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1160191418 18:76717224-76717246 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1160938894 19:1610743-1610765 GGGGACTGACCTGGGCTTGGGGG - Exonic
1161461827 19:4402444-4402466 GAGGCCTGTCATTGGCTGGGAGG - Intergenic
1161474535 19:4476928-4476950 GGGGCATGAATTTGGCGGGGAGG + Intronic
1163568701 19:18067456-18067478 GGGAAATGACAGTGACTGAGTGG - Intronic
1163777205 19:19225503-19225525 GGGGAGTCACCTTTGCTGGGTGG + Intronic
1163847680 19:19646647-19646669 GGGGTGGGAGATTGGCTGGGCGG - Intronic
1165817293 19:38649894-38649916 GGGGCATGGCAGTGGCTTGGTGG + Intronic
1165976536 19:39681404-39681426 GGGGATTGAAAGTGGGTGGGAGG - Intergenic
1167169490 19:47821799-47821821 AGGAGGTGACATTGGCTGGGAGG - Intronic
1168638743 19:58016402-58016424 GGGAGAAGACAATGGCTGGGAGG + Intergenic
925103735 2:1271813-1271835 AGGGAATGCCATTGGCTGATTGG + Intronic
925103745 2:1271879-1271901 AGGGAATGCCATTGGCTGATTGG + Intronic
925461067 2:4063030-4063052 GGAGAAAGATATGGGCTGGGAGG - Intergenic
925655349 2:6141811-6141833 GGAGAAAGACATAGGCTGGGAGG + Intergenic
926098796 2:10100151-10100173 GGGGAATGCCCTGGCCTGGGTGG - Intergenic
926364848 2:12123554-12123576 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
926389714 2:12376512-12376534 GTTCAATGACACTGGCTGGGGGG + Intergenic
926531030 2:14045263-14045285 GGAGAAAGATGTTGGCTGGGAGG - Intergenic
926577250 2:14595748-14595770 GGGGACTGTGACTGGCTGGGAGG + Intergenic
927092160 2:19720256-19720278 AGGCAATGACATTGGGTGGATGG + Intergenic
929271736 2:39980438-39980460 GGAGAAAGATATAGGCTGGGAGG + Intergenic
930618907 2:53624290-53624312 TGGGAATGCCATAGACTGGGTGG - Intronic
931023125 2:58073834-58073856 GGAGAATGATGTAGGCTGGGAGG + Intronic
932209328 2:69914615-69914637 CGGGTCTGGCATTGGCTGGGAGG - Intronic
935184266 2:100717444-100717466 AGGGAAAGACGTAGGCTGGGAGG - Intergenic
935425536 2:102914931-102914953 GGAGAAAGATATAGGCTGGGAGG + Intergenic
935752086 2:106244688-106244710 TCGGTATGACATTGGCTGTGGGG - Intergenic
935912497 2:107912235-107912257 TCGGTATGACATTGGCTGTGGGG - Intergenic
936829034 2:116618233-116618255 GGGGAGTGACAGTGGCTACGGGG - Intergenic
936858224 2:116985333-116985355 GGGGCCTGTCATTGGGTGGGGGG + Intergenic
936973999 2:118201588-118201610 GTGGAGTGACAGTGGCTGGGAGG + Intergenic
937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG + Intronic
937307535 2:120881542-120881564 GGGGAAAGACAGTGGTGGGGAGG + Intronic
937366254 2:121264185-121264207 GTGGAAAGCCAGTGGCTGGGTGG - Intronic
938619069 2:133030734-133030756 GGGGAATACCATAGACTGGGTGG + Intronic
938950705 2:136251921-136251943 AGGGAATGACAGTGGCAGGCTGG + Intergenic
939298630 2:140303811-140303833 GGGGCCTGTCATTGGGTGGGAGG - Intronic
939731754 2:145793307-145793329 GGGGAATGACAGTAGCTGAAGGG + Intergenic
942811795 2:180008586-180008608 GGAGAAAGATATAGGCTGGGAGG - Intergenic
943244513 2:185429195-185429217 GGGGAAAGATGTAGGCTGGGAGG - Intergenic
944516812 2:200520842-200520864 GGGGAATGAGGTTGGAGGGGGGG - Intronic
944877652 2:203978535-203978557 GGAGAAAGATATAGGCTGGGAGG + Intergenic
946226166 2:218265182-218265204 GAGGAATGACAGAGGCAGGGCGG + Intronic
946484681 2:220089594-220089616 GGAGAAAGACGTTGGCTGGGAGG - Intergenic
946527500 2:220537106-220537128 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1169284307 20:4295154-4295176 GGGGAATGACAGTGTGTGTGGGG + Intergenic
1170346295 20:15390328-15390350 GGGGGATGAACTTGGATGGGTGG - Intronic
1170958185 20:21000945-21000967 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1171471566 20:25376030-25376052 GGAGAATGGCATGAGCTGGGAGG + Intronic
1173577687 20:44123609-44123631 GCGGAATGACTGTGGCTGGGAGG + Intronic
1173842096 20:46164323-46164345 GGGGCCTGTGATTGGCTGGGTGG + Intergenic
1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG + Intronic
1175874298 20:62222132-62222154 GGGGAGGGAGAATGGCTGGGCGG - Intergenic
1176409001 21:6437602-6437624 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1177913502 21:27058792-27058814 GGAGAAAGACATAGGCTAGGAGG - Intergenic
1178625615 21:34215700-34215722 GGGACTTGACATAGGCTGGGAGG - Intergenic
1178818849 21:35956810-35956832 GGAGAAAGACGTAGGCTGGGAGG - Intronic
1179684494 21:43045924-43045946 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1179949364 21:44701014-44701036 GGGTAGGGACATTGTCTGGGGGG - Intronic
1181497781 22:23297571-23297593 GAGGAATGCCCTAGGCTGGGTGG - Intronic
1181945169 22:26511236-26511258 GGAGAAAGATATAGGCTGGGAGG + Intronic
1182063237 22:27412776-27412798 CAGGAATGATGTTGGCTGGGGGG - Intergenic
1182696747 22:32203583-32203605 GCGGACTGCCAGTGGCTGGGTGG - Intergenic
1184920201 22:47600609-47600631 GGGGGATGTCAGAGGCTGGGAGG - Intergenic
949638340 3:6008804-6008826 GGAGAAAGACGTAGGCTGGGAGG - Intergenic
951452311 3:22853269-22853291 GGAGAAAGACATAGGCTGGGAGG - Intergenic
954054541 3:48010820-48010842 GGAGAAAGATATAGGCTGGGAGG - Intronic
954413408 3:50381112-50381134 TGAGGATGACAGTGGCTGGGGGG + Exonic
955657270 3:61258105-61258127 GGTGAATGTTATTGGCTGTGTGG + Intergenic
955854791 3:63261555-63261577 GGGGACTGTCATGGGGTGGGGGG + Intronic
957277374 3:78108168-78108190 GGTGAAAGATATAGGCTGGGAGG + Intergenic
957754177 3:84465805-84465827 GAAGAAAGACATAGGCTGGGAGG - Intergenic
958715275 3:97773227-97773249 GGAGAAAGACGTAGGCTGGGAGG + Intronic
958725795 3:97904890-97904912 GGGGACTGTCATGGGGTGGGGGG - Intronic
958789290 3:98632071-98632093 GGAGAAAGATATAGGCTGGGAGG + Intergenic
958849472 3:99306488-99306510 GGGGACTGTCATGGGTTGGGAGG + Intergenic
959586287 3:108027843-108027865 AAGGAATGAAATTGGTTGGGGGG + Intergenic
959748861 3:109809651-109809673 GGATAAAGACATAGGCTGGGAGG + Intergenic
960612015 3:119563331-119563353 GGGGCCTGTCATGGGCTGGGGGG - Intergenic
962829685 3:139129086-139129108 GGGTGATGACATTGGAAGGGTGG + Intronic
963566431 3:146937205-146937227 GGAGAAAGATATAGGCTGGGAGG - Intergenic
963588651 3:147227984-147228006 GGGGCCTGTCATGGGCTGGGGGG - Intergenic
963823615 3:149927155-149927177 GGTGGATGCCAGTGGCTGGGGGG - Intronic
964341617 3:155714393-155714415 GGGGAAGGCCATCTGCTGGGTGG - Intronic
964646606 3:158964876-158964898 GGAGAAAGACGTAGGCTGGGAGG + Intronic
968655563 4:1777108-1777130 GGGGTATGGGATGGGCTGGGGGG + Intergenic
969436334 4:7191625-7191647 GGGGAAGGCCATGGGCAGGGTGG + Intergenic
972883322 4:43452969-43452991 GGAGAAAGATATAGGCTGGGAGG + Intergenic
972900844 4:43681172-43681194 GGTGAATGTCCTTGGGTGGGGGG + Intergenic
974388473 4:61233471-61233493 GGGGACTGAGATTGAGTGGGAGG + Intronic
975257381 4:72254265-72254287 GGAGAAAGACGTAGGCTGGGAGG - Intergenic
977627044 4:99198858-99198880 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
979300848 4:119085645-119085667 GGGGAAATAGATTGGCTGGTTGG - Intergenic
979415561 4:120434208-120434230 GGGGACTGTCATGGGGTGGGGGG - Intergenic
979766579 4:124471298-124471320 GGAGAAAGATATAGGCTGGGAGG - Intergenic
980176293 4:129349150-129349172 GGTGGATGTCAGTGGCTGGGAGG - Intergenic
980405575 4:132351220-132351242 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
980868487 4:138582351-138582373 GGAGAAAGACATAGGCTGGGAGG - Intergenic
981765328 4:148242021-148242043 GGTGCATGACAGGGGCTGGGGGG + Intronic
982391136 4:154864911-154864933 GGGGAAAGATGTAGGCTGGGAGG + Intergenic
982548449 4:156764836-156764858 CTGGAATGAGATTGGGTGGGTGG + Intronic
983178029 4:164614685-164614707 GTGGAAGAGCATTGGCTGGGGGG - Intergenic
985208533 4:187567653-187567675 GAGGAATGTCATTGGATGAGAGG - Intergenic
985616191 5:923270-923292 GGGGCTGGGCATTGGCTGGGAGG - Intergenic
985894565 5:2740691-2740713 GGGGAAGGACGTGGGCCGGGTGG + Intergenic
986026654 5:3857642-3857664 GGGCAATGACAGAGGCAGGGAGG + Intergenic
989071225 5:37513713-37513735 GGAGAAAGACGTAGGCTGGGAGG + Intronic
989264241 5:39454877-39454899 GGAGAATGGCATGAGCTGGGAGG - Intronic
990443754 5:55872767-55872789 GAGCAATGACATTGGCAGGGTGG - Intronic
994358835 5:98826893-98826915 GGAGAAAGATATAGGCTGGGAGG + Intergenic
994939771 5:106307525-106307547 GGGGAAGGTCATTGTCTGTGTGG - Intergenic
995127191 5:108590087-108590109 GGAGAAAGATATAGGCTGGGAGG - Intergenic
995279511 5:110317397-110317419 GGGGAAAGATGTAGGCTGGGAGG + Intronic
996322552 5:122235316-122235338 GGAGAAAGATATAGGCTGGGAGG + Intergenic
996782674 5:127205283-127205305 GTGGAATGATATTTGCTGTGGGG + Intergenic
998906350 5:146909225-146909247 GGGGAATGTCATGGTCTAGGAGG - Intronic
998988932 5:147793438-147793460 GGGGAATGTTATGGGGTGGGAGG - Intergenic
999374110 5:151074866-151074888 GGAGGATGACTTGGGCTGGGAGG - Intronic
999391935 5:151199552-151199574 GGACAATGAGAATGGCTGGGAGG - Intronic
1000719049 5:164682791-164682813 GGAGAATGACATTAGCTGATGGG - Intergenic
1001959170 5:175870087-175870109 GGGGGATGGCAGTGGCAGGGAGG - Intronic
1003663776 6:8089502-8089524 GGAGAAAGACGTAGGCTGGGAGG + Intronic
1004956626 6:20734740-20734762 GTGGAATTACATTGGCTTTGGGG - Intronic
1006194409 6:32229503-32229525 AGGGAAGGGCCTTGGCTGGGGGG - Intergenic
1006350282 6:33515997-33516019 GGGGAGAGACATTGACTGGGAGG - Intergenic
1007186306 6:39975243-39975265 GGGGGATGACATTGGATGTTTGG - Intergenic
1007275048 6:40667181-40667203 AGGGAATCAGAGTGGCTGGGAGG - Intergenic
1007559294 6:42792931-42792953 GGAGAAAGAAATTGGCTGGCTGG + Intronic
1008535596 6:52504328-52504350 GGGGCAGGGCAGTGGCTGGGTGG - Intronic
1008915218 6:56779877-56779899 GGGGAATGTTATGGGGTGGGGGG - Intronic
1009185073 6:60565191-60565213 GGAGAAAGACGTAGGCTGGGGGG - Intergenic
1009629229 6:66172778-66172800 GGGGCCTGTCATTGGGTGGGTGG + Intergenic
1009868197 6:69424115-69424137 GGGGAATGACATTGTCTATTGGG + Intergenic
1010804045 6:80213954-80213976 AGGGAGTGACAGTAGCTGGGAGG + Intronic
1013741319 6:113289804-113289826 GGGGAATAACATTGGATGGGAGG - Intergenic
1013799760 6:113929448-113929470 GGAGAATGATGTAGGCTGGGAGG - Intergenic
1014666377 6:124242877-124242899 GGGGCATGTCAGGGGCTGGGGGG + Intronic
1015267383 6:131302283-131302305 GGAGAAAGATATAGGCTGGGAGG - Intergenic
1015442949 6:133269977-133269999 GGAGAAAGATATAGGCTGGGAGG + Intronic
1015549484 6:134397106-134397128 GGGGGATGACAGTGGCAGAGTGG - Intergenic
1015676509 6:135755987-135756009 GGAGAAGGACATAGGCTGGGGGG - Intergenic
1015834778 6:137408688-137408710 GGGGACTGTCATGGGGTGGGGGG - Intergenic
1015863659 6:137706181-137706203 GGTGAATGACTTTTGCTGGATGG - Intergenic
1016028544 6:139313832-139313854 TTGGAATGCCCTTGGCTGGGAGG - Intergenic
1016594692 6:145786220-145786242 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1018332590 6:162747222-162747244 GGAGAAAGACGTAGGCTGGGAGG - Intronic
1019234623 6:170599967-170599989 TGGGAATGCCATTGGCTGCATGG - Intergenic
1019718064 7:2550699-2550721 GAGAAATGACAGAGGCTGGGAGG + Intronic
1019737838 7:2659320-2659342 GGGGAAGGAGAGTGGGTGGGCGG + Intronic
1020275045 7:6618914-6618936 AGACACTGACATTGGCTGGGGGG - Intronic
1022225056 7:28354382-28354404 GGAGAAAGACATAGGCTGGGAGG - Intronic
1024884044 7:54122079-54122101 GGGGAAAGATGTAGGCTGGGAGG + Intergenic
1026140715 7:67703949-67703971 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1026530074 7:71189553-71189575 CAGGAATGATCTTGGCTGGGAGG + Intronic
1027406734 7:77870462-77870484 GGAGAAAGATATAGGCTGGGAGG + Intronic
1028043424 7:86087961-86087983 GGAGAAAGACATAGGCTGGGAGG - Intergenic
1029114422 7:98229961-98229983 GGGGAATGAGGTTCCCTGGGGGG - Intronic
1030174571 7:106638593-106638615 GGAGAAAGACATAGGCTGGGAGG + Intergenic
1031474130 7:122202776-122202798 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1031861474 7:126984490-126984512 GGAGAAAGATATAGGCTGGGAGG - Intronic
1032744402 7:134771334-134771356 GGGGACGGACATTTGCAGGGAGG - Intronic
1033626094 7:143110969-143110991 TTGGAATGCCATTGGCTGAGAGG + Intergenic
1033705880 7:143884691-143884713 GGGGCATGAGATTTGGTGGGGGG + Intronic
1034275662 7:149822765-149822787 GGGGCACTACATTGGCTGTGAGG - Intergenic
1034435520 7:151061185-151061207 GGGGCATGTGATGGGCTGGGAGG - Intronic
1035525385 8:308528-308550 GGGGGATGACATTTGCTGACTGG + Intergenic
1035551306 8:529013-529035 GGAGAAAGATATAGGCTGGGAGG + Intronic
1035816109 8:2542747-2542769 AGAGAAAGACATAGGCTGGGAGG - Intergenic
1036062613 8:5341169-5341191 GGGGACTGTCTTTGGGTGGGGGG - Intergenic
1036781722 8:11652354-11652376 GGGGACTGCCAGGGGCTGGGGGG - Intergenic
1037755848 8:21709710-21709732 GGGAACTGGCATTGCCTGGGAGG - Intronic
1037838727 8:22229574-22229596 GGGGAGTGACAGCGTCTGGGAGG + Intronic
1038613560 8:29073546-29073568 AGGGAATGAGATTGGTGGGGTGG + Intronic
1039187062 8:34929620-34929642 GGAGAATGATGTAGGCTGGGAGG + Intergenic
1039280025 8:35974418-35974440 GGAGAATGATGTAGGCTGGGAGG + Intergenic
1039411965 8:37362406-37362428 GGGGAATGCCAGAGGGTGGGAGG + Intergenic
1041016090 8:53594485-53594507 GGGGAACGAGTTTGCCTGGGTGG - Intergenic
1041308955 8:56494650-56494672 GGGGGATGCAATTGTCTGGGAGG - Intergenic
1041388632 8:57329938-57329960 GGGGAAGTAGAATGGCTGGGAGG - Intergenic
1043886289 8:85604384-85604406 GGGGAAAGATGTAGGCTGGGAGG + Intergenic
1045533535 8:103006173-103006195 GGGTAATGCCCTTGGCTGAGAGG + Intergenic
1045560697 8:103259519-103259541 GGGGAATGACATTCCATAGGGGG + Intergenic
1046128325 8:109938797-109938819 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1047015796 8:120721890-120721912 GGGGCATGTCATGGGGTGGGGGG - Intronic
1047188213 8:122654745-122654767 GGGGACAGACATTGGCAGGATGG - Intergenic
1047309136 8:123677284-123677306 GTGGAAAGAAGTTGGCTGGGTGG + Intergenic
1047550933 8:125871488-125871510 GGGGAAAGATGTAGGCTGGGAGG + Intergenic
1047814591 8:128448949-128448971 GGGGAATGAGTTTGGGTGAGTGG + Intergenic
1048286776 8:133147669-133147691 GGGGCATGCCAATGGCTGGGAGG - Intergenic
1048908818 8:139114739-139114761 GGAGAAAGACGTAGGCTGGGAGG + Intergenic
1049318142 8:141980575-141980597 GGGCAATGACAGAGGCTGGTTGG + Intergenic
1049694180 8:143975638-143975660 GGGTAAGGCCAGTGGCTGGGGGG - Intronic
1049926168 9:409733-409755 GGGGACTGTCATGGGGTGGGGGG - Intronic
1050173778 9:2849505-2849527 GGGGCCTGTCATGGGCTGGGGGG + Intergenic
1050188209 9:2997487-2997509 GGAGAAAGACGTAGGCTGGGGGG - Intergenic
1051141580 9:13985009-13985031 GGGGAATGTTATGGGGTGGGTGG - Intergenic
1053025897 9:34727919-34727941 GGAGAAAGATAATGGCTGGGAGG - Intronic
1053226021 9:36358362-36358384 TGGGAATAAGATTGGCTAGGCGG - Intronic
1053480318 9:38412010-38412032 TGGGAATGCAATTGGCTGTGCGG - Intronic
1053753461 9:41279180-41279202 GTGGAGTGAGATAGGCTGGGGGG + Intergenic
1053942627 9:43268013-43268035 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1054258985 9:62843543-62843565 GTGGAGTGAGATAGGCTGGGGGG + Intergenic
1054332794 9:63776497-63776519 GTGGAGTGAGATAGGCTGGGGGG - Intergenic
1054966221 9:71029870-71029892 GGGCAATGACATTGCTTTGGTGG + Intronic
1056719021 9:89057794-89057816 GGGGCATGACTTTTGCGGGGAGG - Intronic
1057273001 9:93661066-93661088 GGAGAATGCCATTGGAGGGGAGG + Intronic
1058247544 9:102646911-102646933 GGAGAAAGACATAGGCTGGAAGG - Intergenic
1058619800 9:106870990-106871012 GGGAAATGCCAGAGGCTGGGGGG + Intronic
1060297836 9:122355245-122355267 GGGGAAGGACCTTGGCCTGGGGG + Intergenic
1060720719 9:125975074-125975096 GGGGAACGGCATGGCCTGGGTGG + Intergenic
1062218938 9:135403982-135404004 GGGGATTGACATTGGCTTTGAGG + Intergenic
1062391950 9:136337389-136337411 GGGTGAGGACATGGGCTGGGAGG + Intronic
1062720529 9:138040651-138040673 GGAGAAAGATATAGGCTGGGAGG + Intronic
1202799794 9_KI270719v1_random:164808-164830 GTGGAGTGAGATAGGCTGGGGGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186682051 X:11885372-11885394 GGTGATTGACAGGGGCTGGGGGG + Intergenic
1187437964 X:19289904-19289926 GAGGTGTGACAGTGGCTGGGAGG - Intergenic
1188665744 X:32818782-32818804 AGGGTGTGACATTGGCTGGCAGG - Intronic
1189103510 X:38214420-38214442 GTGGAGTGACATGTGCTGGGGGG - Intronic
1189737635 X:44087786-44087808 GGGGACTGTCATGGGGTGGGGGG - Intergenic
1192411374 X:70936045-70936067 GGGATATCACATTGGGTGGGAGG - Intergenic
1193565906 X:83076822-83076844 GGGGCCTGTCATAGGCTGGGGGG - Intergenic
1194032442 X:88833345-88833367 GGAGAAAGATATAGGCTGGGAGG + Intergenic
1194584186 X:95713304-95713326 GGAGAAAGACGTAGGCTGGGAGG - Intergenic
1194925328 X:99817122-99817144 GGGGAATGTTATGGGGTGGGGGG + Intergenic
1195749290 X:108148218-108148240 GGAGAAAGACGTAGGCTGGGAGG + Intronic
1195881533 X:109597663-109597685 GGAGAAAGACGTGGGCTGGGAGG - Intergenic
1196521119 X:116673074-116673096 GGGGAAAGAGGTAGGCTGGGAGG - Intergenic
1197232319 X:124018435-124018457 GGGGAAACACATTGGATGGATGG + Intronic
1197633886 X:128892380-128892402 AGGTAAAGACATTGGCTAGGAGG - Intergenic
1198799105 X:140431640-140431662 ATGGAATGAAATTGCCTGGGAGG - Intergenic
1199023960 X:142916172-142916194 GGAGAAAGACGTAGGCTGGGAGG - Intergenic
1199341153 X:146678993-146679015 GGGGAAAGATGTAGGCTGGGAGG - Intergenic
1199508845 X:148597022-148597044 GGGTTATGACATCTGCTGGGGGG + Intronic
1201372741 Y:13282906-13282928 CGGGAAAGAAATTGCCTGGGTGG + Intronic