ID: 1072579621

View in Genome Browser
Species Human (GRCh38)
Location 10:96729385-96729407
Sequence CAGGCCCCATTCCATGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072579621_1072579624 -4 Left 1072579621 10:96729385-96729407 CCCAGGACATGGAATGGGGCCTG No data
Right 1072579624 10:96729404-96729426 CCTGCCCTCTGACGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072579621 Original CRISPR CAGGCCCCATTCCATGTCCT GGG (reversed) Intergenic
No off target data available for this crispr