ID: 1072591448

View in Genome Browser
Species Human (GRCh38)
Location 10:96832145-96832167
Sequence ACCTCACCGTGGCCCCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591448_1072591461 15 Left 1072591448 10:96832145-96832167 CCACGCCGGGGCCACGGTGAGGT No data
Right 1072591461 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
1072591448_1072591469 28 Left 1072591448 10:96832145-96832167 CCACGCCGGGGCCACGGTGAGGT No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591448_1072591455 8 Left 1072591448 10:96832145-96832167 CCACGCCGGGGCCACGGTGAGGT No data
Right 1072591455 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
1072591448_1072591468 27 Left 1072591448 10:96832145-96832167 CCACGCCGGGGCCACGGTGAGGT No data
Right 1072591468 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
1072591448_1072591457 12 Left 1072591448 10:96832145-96832167 CCACGCCGGGGCCACGGTGAGGT No data
Right 1072591457 10:96832180-96832202 GCCCCCGCACCGCCCCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591448 Original CRISPR ACCTCACCGTGGCCCCGGCG TGG (reversed) Intergenic