ID: 1072591452

View in Genome Browser
Species Human (GRCh38)
Location 10:96832156-96832178
Sequence GGGCCGGCCTCACCTCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591452_1072591461 4 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591461 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
1072591452_1072591471 24 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591452_1072591455 -3 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591455 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
1072591452_1072591469 17 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591452_1072591457 1 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591457 10:96832180-96832202 GCCCCCGCACCGCCCCCGGCAGG No data
1072591452_1072591468 16 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591468 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
1072591452_1072591470 23 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591452 Original CRISPR GGGCCGGCCTCACCTCACCG TGG (reversed) Intergenic
No off target data available for this crispr