ID: 1072591453

View in Genome Browser
Species Human (GRCh38)
Location 10:96832172-96832194
Sequence GGGCGGTGCGGGGGCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591453_1072591474 19 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591453_1072591477 26 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591453_1072591468 0 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591468 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
1072591453_1072591471 8 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591453_1072591470 7 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG No data
1072591453_1072591476 25 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591453_1072591469 1 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591453 Original CRISPR GGGCGGTGCGGGGGCAGGGC CGG (reversed) Intergenic
No off target data available for this crispr