ID: 1072591454

View in Genome Browser
Species Human (GRCh38)
Location 10:96832176-96832198
Sequence CCGGGGGCGGTGCGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591454_1072591470 3 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG No data
1072591454_1072591477 22 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591454_1072591478 30 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591454_1072591474 15 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591454_1072591476 21 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591454_1072591471 4 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591454_1072591469 -3 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591454_1072591468 -4 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591468 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591454 Original CRISPR CCGGGGGCGGTGCGGGGGCA GGG (reversed) Intergenic