ID: 1072591458

View in Genome Browser
Species Human (GRCh38)
Location 10:96832181-96832203
Sequence TCCTGCCGGGGGCGGTGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591458_1072591480 30 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591480 10:96832234-96832256 CGGCCCCGGGCGACGCGGCTGGG No data
1072591458_1072591468 -9 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591468 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
1072591458_1072591478 25 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591458_1072591477 17 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591458_1072591476 16 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591458_1072591470 -2 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG No data
1072591458_1072591469 -8 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591458_1072591479 29 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG No data
1072591458_1072591471 -1 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591458_1072591474 10 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591458 Original CRISPR TCCTGCCGGGGGCGGTGCGG GGG (reversed) Intergenic