ID: 1072591460

View in Genome Browser
Species Human (GRCh38)
Location 10:96832183-96832205
Sequence CCTCCTGCCGGGGGCGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591460_1072591478 23 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591460_1072591470 -4 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG No data
1072591460_1072591474 8 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591460_1072591476 14 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591460_1072591471 -3 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591460_1072591479 27 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG No data
1072591460_1072591477 15 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591460_1072591469 -10 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591460_1072591480 28 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591480 10:96832234-96832256 CGGCCCCGGGCGACGCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591460 Original CRISPR CCTCCTGCCGGGGGCGGTGC GGG (reversed) Intergenic
No off target data available for this crispr