ID: 1072591462

View in Genome Browser
Species Human (GRCh38)
Location 10:96832184-96832206
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591462_1072591477 14 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591462_1072591479 26 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG No data
1072591462_1072591471 -4 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591462_1072591480 27 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591480 10:96832234-96832256 CGGCCCCGGGCGACGCGGCTGGG No data
1072591462_1072591476 13 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591462_1072591478 22 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591462_1072591470 -5 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG No data
1072591462_1072591474 7 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591462 Original CRISPR GCCTCCTGCCGGGGGCGGTG CGG (reversed) Intergenic