ID: 1072591465

View in Genome Browser
Species Human (GRCh38)
Location 10:96832193-96832215
Sequence GGGCGTCGCGCCTCCTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591465_1072591476 4 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591465_1072591478 13 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591465_1072591479 17 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG No data
1072591465_1072591477 5 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591465_1072591486 29 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591486 10:96832245-96832267 GACGCGGCTGGGCGTGCGCGGGG 0: 1
1: 0
2: 2
3: 16
4: 254
1072591465_1072591474 -2 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591465_1072591484 27 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591484 10:96832243-96832265 GCGACGCGGCTGGGCGTGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 267
1072591465_1072591480 18 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591480 10:96832234-96832256 CGGCCCCGGGCGACGCGGCTGGG No data
1072591465_1072591485 28 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591465 Original CRISPR GGGCGTCGCGCCTCCTGCCG GGG (reversed) Intergenic