ID: 1072591467

View in Genome Browser
Species Human (GRCh38)
Location 10:96832195-96832217
Sequence CCGGGCGTCGCGCCTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591467_1072591478 11 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591467_1072591484 25 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591484 10:96832243-96832265 GCGACGCGGCTGGGCGTGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 267
1072591467_1072591486 27 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591486 10:96832245-96832267 GACGCGGCTGGGCGTGCGCGGGG 0: 1
1: 0
2: 2
3: 16
4: 254
1072591467_1072591476 2 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591476 10:96832220-96832242 CGCGGGTGCGTGCGCGGCCCCGG No data
1072591467_1072591477 3 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591477 10:96832221-96832243 GCGGGTGCGTGCGCGGCCCCGGG No data
1072591467_1072591479 15 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG No data
1072591467_1072591474 -4 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591467_1072591480 16 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591480 10:96832234-96832256 CGGCCCCGGGCGACGCGGCTGGG No data
1072591467_1072591485 26 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591467 Original CRISPR CCGGGCGTCGCGCCTCCTGC CGG (reversed) Intergenic