ID: 1072591469

View in Genome Browser
Species Human (GRCh38)
Location 10:96832196-96832218
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591454_1072591469 -3 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591453_1072591469 1 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591448_1072591469 28 Left 1072591448 10:96832145-96832167 CCACGCCGGGGCCACGGTGAGGT No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591459_1072591469 -9 Left 1072591459 10:96832182-96832204 CCCCGCACCGCCCCCGGCAGGAG No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591458_1072591469 -8 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591460_1072591469 -10 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591456_1072591469 -4 Left 1072591456 10:96832177-96832199 CCTGCCCCCGCACCGCCCCCGGC No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591450_1072591469 23 Left 1072591450 10:96832150-96832172 CCGGGGCCACGGTGAGGTGAGGC No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data
1072591452_1072591469 17 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591469 10:96832196-96832218 CGGCAGGAGGCGCGACGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591469 Original CRISPR CGGCAGGAGGCGCGACGCCC GGG Intergenic
No off target data available for this crispr