ID: 1072591471

View in Genome Browser
Species Human (GRCh38)
Location 10:96832203-96832225
Sequence AGGCGCGACGCCCGGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591460_1072591471 -3 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591450_1072591471 30 Left 1072591450 10:96832150-96832172 CCGGGGCCACGGTGAGGTGAGGC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591454_1072591471 4 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591456_1072591471 3 Left 1072591456 10:96832177-96832199 CCTGCCCCCGCACCGCCCCCGGC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591462_1072591471 -4 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591453_1072591471 8 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591463_1072591471 -9 Left 1072591463 10:96832189-96832211 CCGCCCCCGGCAGGAGGCGCGAC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591452_1072591471 24 Left 1072591452 10:96832156-96832178 CCACGGTGAGGTGAGGCCGGCCC No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591459_1072591471 -2 Left 1072591459 10:96832182-96832204 CCCCGCACCGCCCCCGGCAGGAG No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data
1072591458_1072591471 -1 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591471 10:96832203-96832225 AGGCGCGACGCCCGGGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591471 Original CRISPR AGGCGCGACGCCCGGGCCGC GGG Intergenic