ID: 1072591474

View in Genome Browser
Species Human (GRCh38)
Location 10:96832214-96832236
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591463_1072591474 2 Left 1072591463 10:96832189-96832211 CCGCCCCCGGCAGGAGGCGCGAC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591459_1072591474 9 Left 1072591459 10:96832182-96832204 CCCCGCACCGCCCCCGGCAGGAG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591466_1072591474 -3 Left 1072591466 10:96832194-96832216 CCCGGCAGGAGGCGCGACGCCCG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591454_1072591474 15 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591465_1072591474 -2 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591462_1072591474 7 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591453_1072591474 19 Left 1072591453 10:96832172-96832194 CCGGCCCTGCCCCCGCACCGCCC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591460_1072591474 8 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591458_1072591474 10 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591467_1072591474 -4 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591456_1072591474 14 Left 1072591456 10:96832177-96832199 CCTGCCCCCGCACCGCCCCCGGC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
1072591464_1072591474 -1 Left 1072591464 10:96832192-96832214 CCCCCGGCAGGAGGCGCGACGCC No data
Right 1072591474 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591474 Original CRISPR CCGGGCCGCGGGTGCGTGCG CGG Intergenic