ID: 1072591475

View in Genome Browser
Species Human (GRCh38)
Location 10:96832219-96832241
Sequence CGGGGCCGCGCACGCACCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591475_1072591492 24 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591492 10:96832266-96832288 GGCCGCGGCGGAGGCTGGGCCGG 0: 1
1: 1
2: 13
3: 157
4: 1253
1072591475_1072591489 15 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591489 10:96832257-96832279 CGTGCGCGGGGCCGCGGCGGAGG 0: 1
1: 1
2: 13
3: 90
4: 657
1072591475_1072591493 25 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591493 10:96832267-96832289 GCCGCGGCGGAGGCTGGGCCGGG 0: 1
1: 1
2: 9
3: 123
4: 1241
1072591475_1072591485 2 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591475_1072591480 -8 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591480 10:96832234-96832256 CGGCCCCGGGCGACGCGGCTGGG No data
1072591475_1072591479 -9 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG No data
1072591475_1072591488 12 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591488 10:96832254-96832276 GGGCGTGCGCGGGGCCGCGGCGG 0: 1
1: 1
2: 9
3: 105
4: 703
1072591475_1072591486 3 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591486 10:96832245-96832267 GACGCGGCTGGGCGTGCGCGGGG 0: 1
1: 0
2: 2
3: 16
4: 254
1072591475_1072591495 28 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591495 10:96832270-96832292 GCGGCGGAGGCTGGGCCGGGCGG 0: 1
1: 0
2: 16
3: 135
4: 1155
1072591475_1072591491 20 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591491 10:96832262-96832284 GCGGGGCCGCGGCGGAGGCTGGG 0: 1
1: 1
2: 10
3: 88
4: 715
1072591475_1072591496 29 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591496 10:96832271-96832293 CGGCGGAGGCTGGGCCGGGCGGG 0: 1
1: 1
2: 23
3: 152
4: 949
1072591475_1072591487 9 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591487 10:96832251-96832273 GCTGGGCGTGCGCGGGGCCGCGG 0: 1
1: 1
2: 9
3: 99
4: 636
1072591475_1072591490 19 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591490 10:96832261-96832283 CGCGGGGCCGCGGCGGAGGCTGG 0: 1
1: 0
2: 17
3: 133
4: 881
1072591475_1072591484 1 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591484 10:96832243-96832265 GCGACGCGGCTGGGCGTGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591475 Original CRISPR CGGGGCCGCGCACGCACCCG CGG (reversed) Intergenic