ID: 1072591478

View in Genome Browser
Species Human (GRCh38)
Location 10:96832229-96832251
Sequence GTGCGCGGCCCCGGGCGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591473_1072591478 -8 Left 1072591473 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591454_1072591478 30 Left 1072591454 10:96832176-96832198 CCCTGCCCCCGCACCGCCCCCGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591472_1072591478 -7 Left 1072591472 10:96832213-96832235 CCCGGGCCGCGGGTGCGTGCGCG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591462_1072591478 22 Left 1072591462 10:96832184-96832206 CCGCACCGCCCCCGGCAGGAGGC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591465_1072591478 13 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591464_1072591478 14 Left 1072591464 10:96832192-96832214 CCCCCGGCAGGAGGCGCGACGCC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591467_1072591478 11 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591458_1072591478 25 Left 1072591458 10:96832181-96832203 CCCCCGCACCGCCCCCGGCAGGA No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591463_1072591478 17 Left 1072591463 10:96832189-96832211 CCGCCCCCGGCAGGAGGCGCGAC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591466_1072591478 12 Left 1072591466 10:96832194-96832216 CCCGGCAGGAGGCGCGACGCCCG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591459_1072591478 24 Left 1072591459 10:96832182-96832204 CCCCGCACCGCCCCCGGCAGGAG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591460_1072591478 23 Left 1072591460 10:96832183-96832205 CCCGCACCGCCCCCGGCAGGAGG No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data
1072591456_1072591478 29 Left 1072591456 10:96832177-96832199 CCTGCCCCCGCACCGCCCCCGGC No data
Right 1072591478 10:96832229-96832251 GTGCGCGGCCCCGGGCGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072591478 Original CRISPR GTGCGCGGCCCCGGGCGACG CGG Intergenic
No off target data available for this crispr