ID: 1072591485

View in Genome Browser
Species Human (GRCh38)
Location 10:96832244-96832266
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072591473_1072591485 7 Left 1072591473 10:96832214-96832236 CCGGGCCGCGGGTGCGTGCGCGG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591475_1072591485 2 Left 1072591475 10:96832219-96832241 CCGCGGGTGCGTGCGCGGCCCCG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591466_1072591485 27 Left 1072591466 10:96832194-96832216 CCCGGCAGGAGGCGCGACGCCCG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591467_1072591485 26 Left 1072591467 10:96832195-96832217 CCGGCAGGAGGCGCGACGCCCGG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591465_1072591485 28 Left 1072591465 10:96832193-96832215 CCCCGGCAGGAGGCGCGACGCCC No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591464_1072591485 29 Left 1072591464 10:96832192-96832214 CCCCCGGCAGGAGGCGCGACGCC No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175
1072591472_1072591485 8 Left 1072591472 10:96832213-96832235 CCCGGGCCGCGGGTGCGTGCGCG No data
Right 1072591485 10:96832244-96832266 CGACGCGGCTGGGCGTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type